ID: 1053396307

View in Genome Browser
Species Human (GRCh38)
Location 9:37777474-37777496
Sequence CAAGACCTTAGTACCACATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053396301_1053396307 -1 Left 1053396301 9:37777452-37777474 CCTGTGTCCTTGCCTCTCCCCGC 0: 1
1: 1
2: 3
3: 45
4: 452
Right 1053396307 9:37777474-37777496 CAAGACCTTAGTACCACATATGG 0: 1
1: 0
2: 1
3: 11
4: 174
1053396302_1053396307 -8 Left 1053396302 9:37777459-37777481 CCTTGCCTCTCCCCGCAAGACCT 0: 1
1: 0
2: 0
3: 19
4: 221
Right 1053396307 9:37777474-37777496 CAAGACCTTAGTACCACATATGG 0: 1
1: 0
2: 1
3: 11
4: 174
1053396300_1053396307 17 Left 1053396300 9:37777434-37777456 CCTTGAGAGCAAGCAGAGCCTGT 0: 1
1: 1
2: 2
3: 26
4: 251
Right 1053396307 9:37777474-37777496 CAAGACCTTAGTACCACATATGG 0: 1
1: 0
2: 1
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053396307 Original CRISPR CAAGACCTTAGTACCACATA TGG Intronic