ID: 1053396309

View in Genome Browser
Species Human (GRCh38)
Location 9:37777485-37777507
Sequence TACCACATATGGTGCAGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053396302_1053396309 3 Left 1053396302 9:37777459-37777481 CCTTGCCTCTCCCCGCAAGACCT 0: 1
1: 0
2: 0
3: 19
4: 221
Right 1053396309 9:37777485-37777507 TACCACATATGGTGCAGAATAGG 0: 1
1: 0
2: 2
3: 5
4: 81
1053396306_1053396309 -9 Left 1053396306 9:37777471-37777493 CCGCAAGACCTTAGTACCACATA 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1053396309 9:37777485-37777507 TACCACATATGGTGCAGAATAGG 0: 1
1: 0
2: 2
3: 5
4: 81
1053396304_1053396309 -7 Left 1053396304 9:37777469-37777491 CCCCGCAAGACCTTAGTACCACA 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1053396309 9:37777485-37777507 TACCACATATGGTGCAGAATAGG 0: 1
1: 0
2: 2
3: 5
4: 81
1053396303_1053396309 -2 Left 1053396303 9:37777464-37777486 CCTCTCCCCGCAAGACCTTAGTA 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1053396309 9:37777485-37777507 TACCACATATGGTGCAGAATAGG 0: 1
1: 0
2: 2
3: 5
4: 81
1053396301_1053396309 10 Left 1053396301 9:37777452-37777474 CCTGTGTCCTTGCCTCTCCCCGC 0: 1
1: 1
2: 3
3: 45
4: 452
Right 1053396309 9:37777485-37777507 TACCACATATGGTGCAGAATAGG 0: 1
1: 0
2: 2
3: 5
4: 81
1053396300_1053396309 28 Left 1053396300 9:37777434-37777456 CCTTGAGAGCAAGCAGAGCCTGT 0: 1
1: 1
2: 2
3: 26
4: 251
Right 1053396309 9:37777485-37777507 TACCACATATGGTGCAGAATAGG 0: 1
1: 0
2: 2
3: 5
4: 81
1053396305_1053396309 -8 Left 1053396305 9:37777470-37777492 CCCGCAAGACCTTAGTACCACAT 0: 1
1: 0
2: 1
3: 7
4: 70
Right 1053396309 9:37777485-37777507 TACCACATATGGTGCAGAATAGG 0: 1
1: 0
2: 2
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053396309 Original CRISPR TACCACATATGGTGCAGAAT AGG Intronic