ID: 1053396967

View in Genome Browser
Species Human (GRCh38)
Location 9:37784435-37784457
Sequence CTGCCCTCTGAGACTCCAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053396963_1053396967 6 Left 1053396963 9:37784406-37784428 CCTATGACATCCACTCATTGAGC 0: 1
1: 0
2: 1
3: 5
4: 110
Right 1053396967 9:37784435-37784457 CTGCCCTCTGAGACTCCAAACGG 0: 1
1: 0
2: 3
3: 15
4: 193
1053396961_1053396967 29 Left 1053396961 9:37784383-37784405 CCTGTTCTAGGAGAAATTAACTC 0: 1
1: 0
2: 3
3: 32
4: 191
Right 1053396967 9:37784435-37784457 CTGCCCTCTGAGACTCCAAACGG 0: 1
1: 0
2: 3
3: 15
4: 193
1053396962_1053396967 7 Left 1053396962 9:37784405-37784427 CCCTATGACATCCACTCATTGAG 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1053396967 9:37784435-37784457 CTGCCCTCTGAGACTCCAAACGG 0: 1
1: 0
2: 3
3: 15
4: 193
1053396964_1053396967 -4 Left 1053396964 9:37784416-37784438 CCACTCATTGAGCCTAGTCCTGC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1053396967 9:37784435-37784457 CTGCCCTCTGAGACTCCAAACGG 0: 1
1: 0
2: 3
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053396967 Original CRISPR CTGCCCTCTGAGACTCCAAA CGG Intronic
901808039 1:11750145-11750167 CTGCCCTCTGGGACTGCAAAGGG - Exonic
902095053 1:13936536-13936558 CAGACCTTGGAGACTCCAAAAGG - Intergenic
903527994 1:24007491-24007513 CTCCCATCTTAGTCTCCAAAGGG - Intergenic
905327080 1:37161090-37161112 CTGCCCTTTAAGACCCCAATAGG - Intergenic
907508630 1:54941883-54941905 CTGGCCTATGAGCCCCCAAATGG + Intergenic
907832440 1:58077825-58077847 CTGCCCTCTGAGACTTGAGGTGG - Intronic
908239185 1:62174525-62174547 CAGCACTTTGGGACTCCAAAGGG + Intergenic
910065580 1:83146978-83147000 CTCCCCTCTGAAACTCATAAAGG - Intergenic
910455632 1:87394679-87394701 CTTACATCTGGGACTCCAAACGG - Intergenic
912426107 1:109592376-109592398 CTGCCCCATGAGACAGCAAAAGG - Exonic
919131118 1:193451901-193451923 ATGCCCTCTCAGAAACCAAATGG - Intergenic
921537074 1:216364711-216364733 TTGCCCTCAGAGCCTCCAGAAGG + Intronic
924300602 1:242633709-242633731 CTGCCCTTTGGAACTCCATATGG - Intergenic
1065095954 10:22280937-22280959 CTGCCTCCTCAGCCTCCAAAAGG + Intergenic
1071213809 10:83375550-83375572 CTGCCCTCTGGGACTCTGATTGG + Intergenic
1072097019 10:92191964-92191986 TTGGCCTCAGAGACTGCAAAGGG + Intronic
1073721153 10:106173806-106173828 CTGACCTCAGAGGCTACAAAGGG - Intergenic
1075582650 10:123633969-123633991 CTGCCCTCTGTGACTCCATGAGG - Intergenic
1076273745 10:129178692-129178714 TTTCCCTCTGAGCCTCCAGAAGG - Intergenic
1077725093 11:4666553-4666575 GTGGTCTCTGTGACTCCAAATGG - Intergenic
1078424931 11:11241820-11241842 CTCCCCTCTAAGCCTCCAGAAGG + Intergenic
1079943154 11:26707420-26707442 CTCTCCTCTGAGACTTCAACTGG + Intronic
1082861017 11:57856799-57856821 CTGCCCTCTGAGAGGGAAAAAGG + Intergenic
1083175128 11:60944905-60944927 CTGTCCTTTGAGATTCCAAAAGG + Intronic
1085018805 11:73192292-73192314 CAGCCCTCAGAAACTCCCAATGG - Intergenic
1087085295 11:94212186-94212208 CTGCCCTTTCACACTACAAATGG - Intergenic
1089130387 11:116207771-116207793 GTCCCCTTTGAGCCTCCAAACGG - Intergenic
1090964253 11:131584560-131584582 CTGTCATCTGATATTCCAAAAGG + Intronic
1091184778 11:133637473-133637495 CTGCCCTCTGGAACTGTAAATGG + Intergenic
1091523489 12:1272280-1272302 CTGCCCTCTGTGGTTCCAAGGGG + Intronic
1091690573 12:2594301-2594323 CTTCCTTCTGACACTCCAATTGG + Intronic
1093385628 12:18549823-18549845 CTGCCCTGAGAGACCCCTAAAGG + Intronic
1099102070 12:78454819-78454841 CTGTGCACTGAGACTTCAAAAGG - Intergenic
1099157747 12:79200492-79200514 CAGTCCTCTGAAACTCAAAAGGG + Intronic
1100895243 12:99174623-99174645 CTTCCTTTTCAGACTCCAAATGG - Intronic
1101829511 12:108246444-108246466 CTGCCCTCTGATTCTCCAGCTGG + Intronic
1101942634 12:109111239-109111261 CTGCCAGCTGAGACCCCAGAGGG + Intergenic
1104805068 12:131584573-131584595 CTGCCCTGTTAGTCTCCAGATGG - Intergenic
1108079663 13:46721746-46721768 CTCCTCTCTGAGATTCCAGAAGG + Intronic
1110430498 13:75417388-75417410 CACCACTCTCAGACTCCAAAGGG - Intronic
1112742570 13:102491970-102491992 CTTCCCTATGGGACTCCATATGG + Intergenic
1113645711 13:111993924-111993946 CTGCTCCCTGAGACTCAGAAAGG + Intergenic
1114730483 14:24987689-24987711 CTACCCTCTGCCACTCCATAGGG + Intronic
1116888889 14:50248387-50248409 CTGCCCTCTAAGACTTCAGCTGG + Intronic
1118193326 14:63601080-63601102 TTGTCCTCTAAGCCTCCAAATGG + Intronic
1122373773 14:101244385-101244407 CTGCCATCTGACACTCCCACTGG + Intergenic
1127712192 15:61610514-61610536 CTGTCCTCTAACCCTCCAAATGG - Intergenic
1128330750 15:66753902-66753924 CTGCCCTCGGAGGCCCCAAGGGG + Intronic
1128715447 15:69904495-69904517 CTGCCTTCTGTGAAACCAAAGGG + Intergenic
1129826255 15:78637046-78637068 GGTCCCTCTGAGACACCAAATGG + Intronic
1130067547 15:80617148-80617170 CTCCCCTCAGAGTCTCCAGAAGG - Intergenic
1130094999 15:80849344-80849366 CTGCCCACTGAGCCTCTACACGG + Intronic
1132482532 16:173626-173648 CTGCCCGCTGGGCCTCCCAACGG + Exonic
1133203587 16:4219396-4219418 CAGCCCTCTGAGACTCACCAAGG - Intronic
1133448711 16:5885378-5885400 CTGCCATCTGAGGCCCCCAAAGG + Intergenic
1133618733 16:7505603-7505625 TTGCCTTCTGTAACTCCAAATGG + Intronic
1133880015 16:9772675-9772697 GTGTCCTCCCAGACTCCAAAGGG - Intronic
1135339887 16:21636453-21636475 CTAGCCTCAGAGACTCCAAGAGG + Intronic
1135853729 16:25987616-25987638 CTGTCCCCTTAGACTCCCAAGGG - Intronic
1137306348 16:47204350-47204372 CTTCCCTCAGTGACTCCAACAGG + Intronic
1138492365 16:57383942-57383964 CTGCCCTGTGGGCCCCCAAATGG + Exonic
1140687924 16:77451398-77451420 CTGACCTTTGAAACTCCATATGG + Intergenic
1143054926 17:4155696-4155718 CTGGTCTCTGAGACTCCAGGAGG + Intronic
1143165839 17:4896924-4896946 CTGCCCTCTGAGCTCCCAGAGGG - Intronic
1143989553 17:10944971-10944993 CTGCCCTCTGACACTCACCAGGG + Intergenic
1144823534 17:18092006-18092028 CTGCCCTCTGAGACTGGGCAGGG + Intronic
1146002253 17:29138418-29138440 CTGCCCTCTGTGCCTCTGAATGG - Intronic
1146457924 17:33021591-33021613 CAGGCCTCTGCGCCTCCAAAGGG + Intronic
1147502850 17:40982339-40982361 CTTCCTTCAGAGACTCCACATGG + Exonic
1148494264 17:48043252-48043274 CTGCCTCCTGGGACTCCAAAGGG - Intergenic
1150369382 17:64623376-64623398 CGAACCTCTGAGACTCCAGAAGG + Intronic
1151335453 17:73437074-73437096 TTCCCTTCTGAGACTCCACAAGG - Intronic
1151566237 17:74900117-74900139 CTGCACTGTGAGCTTCCAAAAGG + Intergenic
1152248519 17:79199200-79199222 CTGCCTTCTGAGAATGTAAAGGG + Intronic
1152486848 17:80600149-80600171 CTGGCCTCTAAGAGTCCAAAGGG + Intronic
1152842269 17:82577686-82577708 CGGGCCTCTCAGCCTCCAAAGGG + Intronic
1153374402 18:4359009-4359031 CTTCCCTCTCAAACTCCTAAAGG + Intronic
1153387697 18:4516803-4516825 CTGCCCTCTGTGTCTTCACATGG - Intergenic
1155176107 18:23302664-23302686 CTGGGCTCTGAGACTACAGAAGG - Intronic
1155677712 18:28449777-28449799 CTCCCCTCAGAGGTTCCAAAAGG - Intergenic
1156442591 18:37206446-37206468 TTGCTCTCTGAGGATCCAAAGGG - Intronic
1156505297 18:37586875-37586897 CTGCCCTATCAGCTTCCAAAAGG + Intergenic
1156508861 18:37618034-37618056 CAGCCCTCTAAGAATGCAAATGG - Intergenic
1158208281 18:55019007-55019029 ATGTCCTGTGAGGCTCCAAAGGG - Intergenic
1162981127 19:14240709-14240731 CTGACCTCTGAGTATCCAACAGG + Intergenic
1163490404 19:17614459-17614481 CCGCCTTCTGTGACTCAAAAGGG + Intronic
1163522093 19:17797492-17797514 ATGCCCTTTGAGACTCCACTGGG + Intronic
1163849112 19:19653631-19653653 CTACCTTTGGAGACTCCAAATGG - Intronic
1165100884 19:33438141-33438163 CTGCCCTCTGAGATCCCAGCTGG - Intronic
1165139421 19:33689919-33689941 CAGCCCTCTGTGACTCCAGTGGG - Intronic
1165700057 19:37930599-37930621 TTGCCCTTTGAGATTGCAAAGGG + Intronic
925099374 2:1232197-1232219 GTGCCCTGTGAGACACCACAGGG + Intronic
926533146 2:14077487-14077509 CTGGGGTCTGAGAGTCCAAAAGG - Intergenic
927202550 2:20587450-20587472 CTACCCTCTGAAACACTAAATGG - Intronic
931430720 2:62206797-62206819 CTACCCTACAAGACTCCAAATGG + Intronic
932429117 2:71663396-71663418 CTGCCCTGTGAGACCCCCAGAGG - Intronic
932575151 2:72958748-72958770 CTGCAGCCTGGGACTCCAAATGG - Intronic
934527553 2:95060962-95060984 CTTCCCTCTGAGGCTTAAAAGGG + Intergenic
936087588 2:109479849-109479871 CTGCCCTCAGAGCCTTCATACGG + Intronic
936238871 2:110770081-110770103 CCGCCCTCTGAGACCCCCTAAGG + Intronic
936956410 2:118026910-118026932 CTCCCACCTGAGCCTCCAAAAGG - Intergenic
937301103 2:120842676-120842698 CTGGCCTCTGAGCTTCCTAAGGG + Intronic
937811155 2:126200897-126200919 CTGCCCTCTGAGAGAGCCAAGGG + Intergenic
940738869 2:157484362-157484384 GTGACCTCTGAGAATCCACATGG + Intronic
941997647 2:171615840-171615862 CTGACTTTGGAGACTCCAAAAGG + Intergenic
944976964 2:205064916-205064938 CTTCCCTCAGAAACACCAAATGG + Intronic
946583991 2:221162823-221162845 CTGCTGTGTGAGACTTCAAACGG - Intergenic
946597034 2:221317297-221317319 CTTCACTGTGAGAGTCCAAAGGG - Intergenic
948651359 2:239446495-239446517 CTGCCTTCTGAGAAGGCAAAGGG - Intergenic
1170119942 20:12900861-12900883 CTGCCCTCTGTGGCTGCAGAGGG + Intergenic
1172298202 20:33828964-33828986 ATGGCCTCTGAGATTCTAAAAGG - Intronic
1173572219 20:44084862-44084884 CTCCCCTCAGAGCCTCCAGAAGG + Intergenic
1173578571 20:44129949-44129971 CTCCCCTTTGAGCCTCCAGAAGG + Intronic
1174875230 20:54220763-54220785 CTGGCCTTTGAGGGTCCAAAAGG - Intronic
1175156104 20:56972750-56972772 CTGCCTTCTGGGGCCCCAAATGG - Intergenic
1175278775 20:57788763-57788785 CTGCCCTCTGTGACTTCACTCGG + Intergenic
1175595791 20:60231696-60231718 CTGCCCTCTCAGATGCCAAACGG + Intergenic
1178928517 21:36795738-36795760 CTGCCCTCAGTTCCTCCAAAAGG - Intronic
1179312957 21:40212998-40213020 GTGCCCTCAGAGCCTCCAGAAGG + Intronic
1179794021 21:43771977-43771999 CTGCCCTCTGAGAGTGCATTAGG - Intergenic
1182668802 22:31978553-31978575 CTGCCCTCTGAGCACCAAAAAGG - Intergenic
1182869331 22:33632502-33632524 CTGACCTCTGAGACCCCCACTGG - Intronic
1183377543 22:37473902-37473924 CTGCCCTCTGACACTGTAGATGG - Intronic
1183777317 22:39974986-39975008 CTGGCCTTTCAGCCTCCAAATGG + Intergenic
1185050365 22:48551108-48551130 CTGCTCACTGAGACACCACAGGG - Intronic
949469452 3:4379467-4379489 CTTCCCTTAGAGACTCCAGATGG + Intronic
951820064 3:26798405-26798427 CTCCCCTCAGAGCCTCCAGAAGG + Intergenic
952534496 3:34295627-34295649 CTGACCTCTGATACTCCACATGG - Intergenic
952534500 3:34295657-34295679 CTGACCTCTGATACTCCACATGG - Intergenic
952534507 3:34295717-34295739 CTGACCTCTGATATTCCACATGG - Intergenic
952534511 3:34295747-34295769 CTGACCTCTGATACTCCACATGG - Intergenic
953162892 3:40437897-40437919 ATCCCCTCAGAGTCTCCAAAAGG + Intergenic
955662080 3:61311617-61311639 AAGGACTCTGAGACTCCAAAAGG - Intergenic
955737712 3:62057413-62057435 CTGCCTTGTGGGACTCCCAAAGG + Intronic
956072306 3:65466573-65466595 CTGGCCTCTCTGACTCCACAGGG + Intronic
956888440 3:73584902-73584924 CTGCCATCTAACACTCCAAAAGG + Intronic
957196784 3:77079028-77079050 CTGCCCCCTGAGCCTCCTGAAGG + Intronic
960255555 3:115507077-115507099 ATGTCCTCTAAGACTCCCAAAGG - Intergenic
961269614 3:125679451-125679473 CTGCTCACTGAGAAGCCAAAAGG - Intergenic
961381746 3:126500057-126500079 CTGCTCTCTGGGCCTCCAAGAGG + Exonic
961463352 3:127067063-127067085 CTGACCTCTGTGCCACCAAATGG - Intergenic
964310295 3:155385151-155385173 CTGGCCTCTGAAACTCCAGAGGG - Intronic
964513291 3:157477169-157477191 ATGCCCTCAGAGCCTCCAGAGGG - Intronic
965716449 3:171609728-171609750 CTGACGTTGGAGACTCCAAAAGG + Intronic
967292814 3:187937768-187937790 TTGCCATCTGAGACTCGAAGGGG - Intergenic
967891879 3:194369560-194369582 CTCCCCTCGGAGACCCCAGAAGG - Intronic
968718753 4:2182498-2182520 TTTCCCTCAGAGACTCCAGAAGG + Intronic
969521029 4:7677880-7677902 CTGCCCTCTGAGCCTCTAGGAGG + Intronic
973576078 4:52290683-52290705 CTGGCCTCCGACACTCCATATGG + Intergenic
975943885 4:79681577-79681599 GTGACCTCTGACACTCAAAATGG - Intergenic
981403664 4:144342203-144342225 CTGTCCTGTGAGACTCAAGAAGG + Intergenic
982116833 4:152105085-152105107 CTTCCCTCTGACCCTCCAAGAGG - Intergenic
982127851 4:152199862-152199884 CTGTCCTCTAACACTCCAACAGG - Intergenic
983446078 4:167854576-167854598 CTGCAGTCTGAGACTCACAAAGG - Intergenic
983981258 4:174000178-174000200 CTGGCCTGTTAGACTCCAAAAGG - Intergenic
984111576 4:175623048-175623070 CTGCCCTCAGTGACTGCAAGGGG + Intergenic
985986869 5:3523283-3523305 CTTCCCACTTAAACTCCAAAAGG + Intergenic
986620103 5:9663968-9663990 TTTCCCTCAGAGCCTCCAAAAGG + Intronic
988884822 5:35545260-35545282 CTCCCCTCAGAGGCTCCAGAAGG - Intergenic
989019943 5:36992622-36992644 CTCCCATCTCAGCCTCCAAATGG + Intronic
990194199 5:53294600-53294622 CTGCCCTCTGAGTCTAGTAATGG + Intergenic
990506671 5:56452002-56452024 TTTCCCTCTGAGCCTCCAGAAGG + Intergenic
990575260 5:57117738-57117760 TAGCACACTGAGACTCCAAAGGG - Intergenic
994068327 5:95568976-95568998 ATGTCCTCTGAGACTCCAACCGG + Intronic
995518121 5:112974366-112974388 CTGGCCTCTAAGAGCCCAAAAGG + Intergenic
997857349 5:137384060-137384082 CTGCCCTCTGAGTCCCCAGCTGG + Intronic
1000274708 5:159723618-159723640 CTGGCCTGTGCGACTCCACATGG - Intergenic
1000434001 5:161185534-161185556 CTGCCCTGTGGGACTCCAGAGGG + Intergenic
1002940158 6:1708757-1708779 CTGCCATCTGAAACAGCAAAAGG + Intronic
1003082702 6:3034571-3034593 CTACCCTCACAGTCTCCAAAGGG + Intergenic
1003222316 6:4171890-4171912 CTGCCCTCTGGCACTCCAACTGG + Intergenic
1003832239 6:10024299-10024321 CTGACCAGTGAGACTGCAAAAGG - Intronic
1007414564 6:41684162-41684184 CTGCCATCTGAGTCCCAAAAAGG + Exonic
1012948438 6:105492445-105492467 CTGCCCTCTGAGACTGCCAAAGG + Intergenic
1015886850 6:137926371-137926393 CAGCCCTCTGAGTCAACAAAGGG + Intergenic
1017398464 6:154030938-154030960 CTGCTCTCTGAACCTGCAAATGG + Intronic
1018199891 6:161384892-161384914 CTCCCCTATGAGCCTCTAAAGGG + Intronic
1018230462 6:161670354-161670376 TTGCCCTCAGAGCCTCCAGAAGG - Intronic
1020990815 7:15194227-15194249 CTGCCATCTGATTTTCCAAACGG - Intergenic
1021421232 7:20447187-20447209 CAGCCATCTGAAACTGCAAACGG - Intergenic
1021602676 7:22379849-22379871 CCACCCTCTCAGCCTCCAAAAGG - Intergenic
1027278529 7:76587775-76587797 CTCCCCTCTGAAACTCATAAAGG + Intergenic
1030318151 7:108137368-108137390 CTCCCCTCAGAGCCTCCAGAAGG - Intergenic
1037817192 8:22118473-22118495 CTGCCTTCTGAGACTCCGTCCGG - Intronic
1039343615 8:36678916-36678938 CTGCTCTCTCATACTCCAGACGG + Intergenic
1041379993 8:57244620-57244642 CTGCCTTCTGAGTATCCCAAGGG + Intergenic
1044995560 8:97835011-97835033 CCTCCCTCTGAGACTCTAATGGG + Intronic
1046379322 8:113432875-113432897 CCACCCTCGGAGACTCCTAAAGG + Intronic
1046905351 8:119566424-119566446 CTGCCTTCTGAAACTCTGAATGG + Intronic
1048136737 8:131753385-131753407 CTGCCTTCTGAGTGACCAAATGG - Intergenic
1049383820 8:142331015-142331037 CTGCCCCCTGCTACTCCATATGG + Intronic
1049444480 8:142623729-142623751 GTGACCTCTGAGGCCCCAAAGGG + Intergenic
1049477004 8:142801525-142801547 CTGCCCTCTGAAACTGCCACTGG + Intergenic
1050308317 9:4328202-4328224 CTGCCCTCTGAAGCTGCAAAGGG - Intronic
1050453068 9:5804372-5804394 CTTCCCTCTGGGAATCCCAAGGG + Intronic
1053396967 9:37784435-37784457 CTGCCCTCTGAGACTCCAAACGG + Intronic
1053800446 9:41760658-41760680 AAGCCCTCTGTGACCCCAAAAGG - Intergenic
1059997396 9:119925401-119925423 CTGCCCCCTAAAAATCCAAAAGG - Intergenic
1060218107 9:121750562-121750584 CTGCCCTGTGTGGCCCCAAAGGG - Intronic
1061438044 9:130579279-130579301 AGTCCCTCTGAGATTCCAAACGG + Intronic
1061456429 9:130701364-130701386 CTGTCATCTGAGCCTCTAAATGG + Intronic
1061551354 9:131336606-131336628 CTGCCCTTTGAGCCTCCAAAGGG - Intergenic
1061776126 9:132965736-132965758 CATCCCTCGGAGACTCCAGAAGG + Intronic
1185712560 X:2315727-2315749 CAGCCTTGTGAGACTCTAAATGG - Intronic
1189219524 X:39359327-39359349 CTGCCCTCTCACTCTCCAATGGG - Intergenic
1189551540 X:42098796-42098818 TTGCCCTCTGAGACGCCATGGGG - Intergenic
1189947563 X:46194745-46194767 CTCCCCTCAGAGCCTCCAGAAGG + Intergenic
1192563309 X:72141859-72141881 CTCCCCTCTGAGATTCAAATAGG + Intergenic
1194865750 X:99064061-99064083 CTGCTCTAGGAGACACCAAAAGG - Intergenic
1197056100 X:122121306-122121328 CTCCCTTCAGAGGCTCCAAAAGG - Intergenic
1202375871 Y:24235932-24235954 CTCCCCTCTTAGTCCCCAAATGG - Intergenic
1202494909 Y:25434186-25434208 CTCCCCTCTTAGTCCCCAAATGG + Intergenic