ID: 1053397139

View in Genome Browser
Species Human (GRCh38)
Location 9:37785327-37785349
Sequence TCGTATCCCCACGATGCGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053397139_1053397146 28 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA No data
Right 1053397146 9:37785378-37785400 TCTCTGGAAGCTGAGCAGAGGGG No data
1053397139_1053397145 27 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA No data
Right 1053397145 9:37785377-37785399 ATCTCTGGAAGCTGAGCAGAGGG No data
1053397139_1053397141 4 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA No data
Right 1053397141 9:37785354-37785376 CTTCCACTTAAGAGTTTCTTGGG No data
1053397139_1053397143 12 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA No data
Right 1053397143 9:37785362-37785384 TAAGAGTTTCTTGGGATCTCTGG No data
1053397139_1053397144 26 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA No data
Right 1053397144 9:37785376-37785398 GATCTCTGGAAGCTGAGCAGAGG No data
1053397139_1053397140 3 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA No data
Right 1053397140 9:37785353-37785375 ACTTCCACTTAAGAGTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053397139 Original CRISPR TCGTATCCCCACGATGCGAC CGG (reversed) Intronic