ID: 1053397139

View in Genome Browser
Species Human (GRCh38)
Location 9:37785327-37785349
Sequence TCGTATCCCCACGATGCGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 24}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053397139_1053397140 3 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1053397140 9:37785353-37785375 ACTTCCACTTAAGAGTTTCTTGG No data
1053397139_1053397146 28 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1053397146 9:37785378-37785400 TCTCTGGAAGCTGAGCAGAGGGG No data
1053397139_1053397143 12 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1053397143 9:37785362-37785384 TAAGAGTTTCTTGGGATCTCTGG No data
1053397139_1053397145 27 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1053397145 9:37785377-37785399 ATCTCTGGAAGCTGAGCAGAGGG No data
1053397139_1053397144 26 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1053397144 9:37785376-37785398 GATCTCTGGAAGCTGAGCAGAGG No data
1053397139_1053397141 4 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1053397141 9:37785354-37785376 CTTCCACTTAAGAGTTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053397139 Original CRISPR TCGTATCCCCACGATGCGAC CGG (reversed) Intronic
900002340 1:21606-21628 TTGTGTCCCCACGGTGCCACGGG - Intergenic
900022059 1:192130-192152 TTGTGTCCCCACGGTGCCACGGG - Intergenic
913547753 1:119886285-119886307 TCCTTTGCCCACGCTGCGACAGG + Intergenic
914199805 1:145474936-145474958 TCCTATCCCCAGGATGGGCCTGG - Intergenic
914201116 1:145486644-145486666 TCCTATCCCCAGGATGTGCCTGG - Intergenic
914313234 1:146486176-146486198 TCCTATCCCCAGGATGGGCCTGG - Intergenic
914478924 1:148048071-148048093 TCCTATCCCCAGGATGGGCCTGG - Intergenic
914480229 1:148059776-148059798 TCCTATCCCCAGGATGTGCCTGG - Intergenic
914501113 1:148247205-148247227 TCCTATCCCCAGGATGGGCCTGG + Intergenic
1091375758 12:23668-23690 TTGTGTCCCCACGGTGCCACGGG - Intergenic
1100927000 12:99559518-99559540 TCTTTTCCCCACCATGCAACTGG - Intronic
1107523490 13:41206185-41206207 TGGGATCCCCATGATGGGACTGG + Intergenic
1132451172 15:101969333-101969355 TTGTGTCCCCACGGTGCCACGGG + Intergenic
1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG + Intronic
1142070149 16:88087371-88087393 TCGTTTCCCCACTAGGTGACTGG - Intronic
1143091690 17:4452761-4452783 TGGGATCCCCAGGATGAGACAGG + Intronic
1160634092 19:63214-63236 TTGTGTCCCCACGGTGCCACGGG - Intergenic
1160933315 19:1580982-1581004 CCGTCTCCCCACGATGCTGCTGG - Intronic
926539474 2:14157178-14157200 TCATATTCCCACTATGTGACAGG + Intergenic
936567387 2:113591814-113591836 TTGTGTCCCCACGGTGCCACGGG + Intergenic
938476465 2:131619110-131619132 TTGTATCACCAGGATGCGTCAGG + Intergenic
1005138461 6:22598907-22598929 TAGTATCTCCACGAAGCCACAGG - Intergenic
1041513619 8:58676598-58676620 TCATATCCCGACGGGGCGACAGG + Intergenic
1049885146 9:21719-21741 TTGTGTCCCCACGGTGCCACGGG - Intergenic
1053397139 9:37785327-37785349 TCGTATCCCCACGATGCGACCGG - Intronic