ID: 1053397140

View in Genome Browser
Species Human (GRCh38)
Location 9:37785353-37785375
Sequence ACTTCCACTTAAGAGTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053397139_1053397140 3 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1053397140 9:37785353-37785375 ACTTCCACTTAAGAGTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053397140 Original CRISPR ACTTCCACTTAAGAGTTTCT TGG Intronic
No off target data available for this crispr