ID: 1053397142

View in Genome Browser
Species Human (GRCh38)
Location 9:37785357-37785379
Sequence GATCCCAAGAAACTCTTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 104}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053397142_1053397145 -3 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397145 9:37785377-37785399 ATCTCTGGAAGCTGAGCAGAGGG No data
1053397142_1053397153 30 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397153 9:37785410-37785432 TTGGACGCTGGGGCCGGGCGCGG No data
1053397142_1053397146 -2 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397146 9:37785378-37785400 TCTCTGGAAGCTGAGCAGAGGGG No data
1053397142_1053397149 19 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397149 9:37785399-37785421 GGCTTTGAAAATTGGACGCTGGG No data
1053397142_1053397151 24 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397151 9:37785404-37785426 TGAAAATTGGACGCTGGGGCCGG No data
1053397142_1053397144 -4 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397144 9:37785376-37785398 GATCTCTGGAAGCTGAGCAGAGG No data
1053397142_1053397147 11 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397147 9:37785391-37785413 AGCAGAGGGGCTTTGAAAATTGG No data
1053397142_1053397148 18 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397148 9:37785398-37785420 GGGCTTTGAAAATTGGACGCTGG No data
1053397142_1053397152 25 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397152 9:37785405-37785427 GAAAATTGGACGCTGGGGCCGGG No data
1053397142_1053397150 20 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397150 9:37785400-37785422 GCTTTGAAAATTGGACGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053397142 Original CRISPR GATCCCAAGAAACTCTTAAG TGG (reversed) Intronic
902209852 1:14896747-14896769 GATCACAAGAAACTGTCATGGGG - Intronic
904158976 1:28508139-28508161 GATTCCAAGTAACTCTTATTTGG + Intronic
904918993 1:33991839-33991861 GATACCAAGAATATATTAAGTGG + Intronic
907507786 1:54933962-54933984 AGTACCAAGAAACTGTTAAGAGG - Intergenic
912864282 1:113243407-113243429 TTTCCTAAGACACTCTTAAGAGG + Intergenic
916615580 1:166435700-166435722 CATCCCAAGAAACTCTAATATGG + Intergenic
921262040 1:213393277-213393299 GATCCCAAGAGATATTTAAGTGG - Intergenic
921465333 1:215480457-215480479 AATAGCAAGAAACTCTTAAGAGG - Intergenic
1069589547 10:69633263-69633285 GTTCCCAAGATACTTTTAGGTGG + Exonic
1070045294 10:72828401-72828423 GATCCCAAGATTTTCTTAAAGGG + Intronic
1074323389 10:112424029-112424051 TATCCCAAGAAACTCATAAGAGG - Intronic
1074593876 10:114842035-114842057 GAACCCAAGAAACTACTCAGGGG - Intronic
1085371695 11:76013340-76013362 AATTCCAACAAACTTTTAAGGGG - Intronic
1085496483 11:76974530-76974552 GATCCTGAGACACTTTTAAGTGG - Intronic
1085497049 11:76979170-76979192 GATCCTGAGACACTTTTAAGTGG + Intronic
1089800139 11:121021308-121021330 GACACCCAGAAACGCTTAAGAGG - Intergenic
1092783958 12:12011322-12011344 GCTCCCAGGAAACTCCTGAGAGG + Intergenic
1093267297 12:17018279-17018301 GATACAAAGATACTTTTAAGAGG - Intergenic
1093848719 12:24009485-24009507 GAACCCATGAATCTCTTCAGTGG - Intergenic
1094433623 12:30397664-30397686 GACCCCAAGAGACTCATAAAGGG - Intergenic
1095964974 12:47860802-47860824 GATCAGAAGTAAGTCTTAAGGGG - Intronic
1097196492 12:57244951-57244973 TATCCCAGGAAACCCTGAAGGGG - Exonic
1106602886 13:31202061-31202083 GATTCCAAGAACATCGTAAGTGG - Intronic
1110350187 13:74498034-74498056 AATCCTAAGAAAACCTTAAGGGG - Intergenic
1114024283 14:18510575-18510597 GATCCCAGAAAACTGTTACGAGG + Intergenic
1114351887 14:21861638-21861660 TATCCCTAGAAACACTTATGAGG - Intergenic
1115823662 14:37239502-37239524 GATCCTAAGAAACTATAATGTGG + Intronic
1116912974 14:50491054-50491076 GATTGCAAGAAAGTTTTAAGAGG - Intronic
1119944018 14:78673060-78673082 GATGCCAATAAACTCTAATGTGG - Intronic
1121489992 14:94351164-94351186 GATCCCAAGAAAGGCTGAGGCGG + Intergenic
1124438500 15:29670511-29670533 CAGCCCAACAACCTCTTAAGTGG - Intergenic
1130245250 15:82241633-82241655 GCTCCCAATAAGCTCTTAAGTGG - Intronic
1131917496 15:97285670-97285692 GAAACCCAGAAACTCTTAACAGG + Intergenic
1132170682 15:99650953-99650975 ACTCCCAAGAAACTGTTAACTGG - Intronic
1133211977 16:4268368-4268390 CAACCCATGAAACTCTTAGGGGG + Intronic
1133959779 16:10483415-10483437 CAGCCCAAGAAACTCTGAACGGG + Exonic
1139318345 16:66092465-66092487 AATCCCAAGAAACTCTGTAGGGG - Intergenic
1140329108 16:74035887-74035909 ATTCCCAATAAAGTCTTAAGGGG + Intergenic
1140650806 16:77086001-77086023 GATACCAAGAAACTCTGAACAGG - Intergenic
1141097037 16:81170317-81170339 GATCCCAAGAAACACTTGTGGGG + Intergenic
1148026625 17:44593360-44593382 AATCCCCAGAAACTCCAAAGGGG - Intergenic
1151359002 17:73577271-73577293 TATCCAAAAAAACTCTTAAGTGG + Intronic
1155128566 18:22905571-22905593 GTTCTCAAGAAACTATTATGTGG - Intronic
1157995086 18:52545358-52545380 GATCCCCAGAAGCTGGTAAGTGG + Intronic
1160079723 18:75714073-75714095 TATCCCCAGAAATTCATAAGAGG - Intergenic
1168168023 19:54567116-54567138 GATGCCAGGCAACTCTTGAGCGG + Intergenic
926232895 2:11018413-11018435 GATCCCATGAAGATCTTAAGGGG + Intergenic
926447476 2:12961465-12961487 ATTCCTAAGAAACTTTTAAGAGG + Intergenic
926608711 2:14923685-14923707 GATTCCTAGAAACTTTCAAGTGG + Intergenic
926779386 2:16454115-16454137 GATTAAAAGAACCTCTTAAGTGG + Intergenic
927366515 2:22303259-22303281 GATCAGAAAAAACTCTTAAGAGG + Intergenic
934900754 2:98158101-98158123 GATTACAAGAAACTCTTCAGAGG - Intronic
936665304 2:114587646-114587668 GATTCCAAGAAAAACTTAAAGGG + Intronic
944411286 2:199445456-199445478 GTTCCCAAGAAACTTTGAGGAGG - Intronic
944939032 2:204603053-204603075 TATCCTATGAAACTCTAAAGAGG + Intronic
946895169 2:224316986-224317008 GAGCCCAAGAAAACCTTCAGGGG + Intergenic
947686572 2:232091168-232091190 GATACCAAGAAAATTTTAATTGG - Intronic
1172395842 20:34604373-34604395 TATCCAAATAAACTCTTAAAGGG + Intronic
1174237080 20:49102953-49102975 GATCCCGAGTCCCTCTTAAGTGG + Intergenic
1177538161 21:22456782-22456804 GAACCCAATAGACTCTGAAGAGG - Intergenic
1180448445 22:15438058-15438080 GATCCCAGAAAACTGTTATGAGG + Intergenic
950337165 3:12204868-12204890 CTTCCCAAGATCCTCTTAAGGGG - Intergenic
951183442 3:19684898-19684920 GATCCCCAGAATCTCTGAATGGG + Intergenic
954088969 3:48269890-48269912 GACTCCAAGTATCTCTTAAGGGG - Exonic
955640464 3:61077612-61077634 GATCCCAAGAAACTCTCCAGTGG + Intronic
956615513 3:71167627-71167649 GATCCCAAGAAAGTCTTAAGAGG + Intronic
958255955 3:91325110-91325132 GCTGCCAAGAAAGTCTTAAGGGG + Intergenic
962215571 3:133518040-133518062 GTTCCCAACAAATTATTAAGTGG + Intergenic
962373522 3:134840833-134840855 CTTCCCAGGAAACTCTTAAAGGG - Intronic
963300100 3:143587753-143587775 GATCCCATGACACTCTTCAAAGG + Intronic
965023545 3:163267257-163267279 TATCCTAAGACACTATTAAGAGG + Intergenic
966246308 3:177811734-177811756 CATCCCAAGAGCCACTTAAGAGG + Intergenic
966471744 3:180297341-180297363 GATCCCAGGAAACACCTTAGGGG - Intergenic
966789969 3:183658317-183658339 GTTTCCAAGATACTGTTAAGTGG - Intronic
971465279 4:26951860-26951882 GATGGCAAGAAACACTCAAGTGG + Intronic
973880741 4:55269022-55269044 TATCCCAAACACCTCTTAAGGGG - Intergenic
978860924 4:113448125-113448147 GAAGCCAAGAAACTGTTAGGAGG + Intergenic
981071139 4:140540249-140540271 GATCCCAAGACAGACTTCAGAGG + Exonic
981902114 4:149878889-149878911 GATTCAAAGAAACTCTTACCTGG - Intergenic
987033375 5:13996370-13996392 AGTCCCAAAAAACTCTTAACTGG + Intergenic
990799526 5:59584803-59584825 CCTCCCAAGCAAATCTTAAGAGG + Intronic
994635461 5:102340338-102340360 GAGCCCATGAAACTCTAAAAAGG - Intergenic
995287186 5:110403395-110403417 TATCCCAGCAAACTCTAAAGGGG - Intronic
999826160 5:155275529-155275551 GATTCCAAGAAATTGTTGAGTGG - Intergenic
1000571809 5:162924130-162924152 GAAACCAAGAAACTGTTAAGAGG - Intergenic
1003268026 6:4583632-4583654 CACCCCATGAAACTCTAAAGAGG - Intergenic
1004344111 6:14832545-14832567 GACACCAAGAAAAGCTTAAGGGG + Intergenic
1006027555 6:31157281-31157303 GAACCCAAGCAACTATCAAGTGG + Intronic
1011352916 6:86442657-86442679 CTTCCTAAGAAACTGTTAAGGGG - Intergenic
1012818481 6:104054854-104054876 AGTCCCTAGAAACTCTCAAGGGG + Intergenic
1014204212 6:118638663-118638685 GATCCCAAGAAACTCTACATTGG + Intronic
1014942107 6:127454031-127454053 GCTTCCAAGAAACAGTTAAGAGG - Exonic
1018650621 6:165988727-165988749 GACCCCAAAAGACCCTTAAGAGG + Intergenic
1022046475 7:26626259-26626281 GATCCAAAGTAGCTCTTGAGGGG + Intergenic
1023082966 7:36543055-36543077 GATCGCTAGAGTCTCTTAAGGGG + Intronic
1023575556 7:41622620-41622642 GTTCCCAAGCTTCTCTTAAGTGG - Intergenic
1023618070 7:42041037-42041059 AATCCCAAGAAACATTTAAAAGG + Intronic
1027844195 7:83350953-83350975 GAGCCCAAGAAAATATTTAGAGG + Intergenic
1032610829 7:133411059-133411081 GATCTTAAGAGTCTCTTAAGAGG + Intronic
1037069210 8:14622325-14622347 GACCCCAAGAAACTCATAGAAGG - Intronic
1037269960 8:17115786-17115808 GATCTCAAGAAACTCTGCACAGG - Intronic
1040494033 8:47950321-47950343 GATCCTAAAATAATCTTAAGGGG - Intronic
1046624757 8:116564450-116564472 GATCCTAAGAAAATCCTCAGAGG - Intergenic
1046930615 8:119838122-119838144 CTTCCCTAGAAACTCTTAGGTGG - Intronic
1047323732 8:123816365-123816387 AATCCTAAGAAGGTCTTAAGAGG + Intergenic
1048032814 8:130649177-130649199 GATCCCAGTAGACTCTTAAAAGG - Intergenic
1048225217 8:132578700-132578722 GATCTCAAGAAAGTTTTCAGTGG - Intronic
1049009888 8:139880277-139880299 GATGCCAAGGGCCTCTTAAGTGG + Intronic
1051160018 9:14197226-14197248 GATCCTAAGAAAGTCAGAAGGGG - Intronic
1052263837 9:26548839-26548861 GATCATAAGAAACCCTTCAGGGG - Intergenic
1053397142 9:37785357-37785379 GATCCCAAGAAACTCTTAAGTGG - Intronic
1053441764 9:38122281-38122303 TTTCCCAAGAAAATCTTGAGTGG - Intergenic
1057868148 9:98697750-98697772 GAGCCCAAGTAACCCTTCAGAGG - Intronic
1058906214 9:109484592-109484614 GATCCTGAAAAACTCTTCAGTGG + Intronic
1062059162 9:134485741-134485763 GATCCCAAGAAGCTCTGATACGG + Intergenic
1186091090 X:6049664-6049686 CATCAGAAAAAACTCTTAAGAGG + Intronic
1189400420 X:40662971-40662993 GATCCAAGGAATCTCTCAAGTGG + Exonic
1192140092 X:68639517-68639539 CATCCCAAGAAACTCCTACAAGG + Intergenic
1196891743 X:120297987-120298009 GATTCCATGAAGCTCTTGAGGGG - Intronic
1201050290 Y:9925991-9926013 GATCCCAAGAAACTATAGAAAGG - Intergenic