ID: 1053397144 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:37785376-37785398 |
| Sequence | GATCTCTGGAAGCTGAGCAG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053397139_1053397144 | 26 | Left | 1053397139 | 9:37785327-37785349 | CCGGTCGCATCGTGGGGATACGA | 0: 1 1: 0 2: 0 3: 0 4: 24 |
||
| Right | 1053397144 | 9:37785376-37785398 | GATCTCTGGAAGCTGAGCAGAGG | No data | ||||
| 1053397142_1053397144 | -4 | Left | 1053397142 | 9:37785357-37785379 | CCACTTAAGAGTTTCTTGGGATC | 0: 1 1: 1 2: 2 3: 12 4: 104 |
||
| Right | 1053397144 | 9:37785376-37785398 | GATCTCTGGAAGCTGAGCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053397144 | Original CRISPR | GATCTCTGGAAGCTGAGCAG AGG | Intronic | ||
| No off target data available for this crispr | |||||