ID: 1053397145

View in Genome Browser
Species Human (GRCh38)
Location 9:37785377-37785399
Sequence ATCTCTGGAAGCTGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053397139_1053397145 27 Left 1053397139 9:37785327-37785349 CCGGTCGCATCGTGGGGATACGA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1053397145 9:37785377-37785399 ATCTCTGGAAGCTGAGCAGAGGG No data
1053397142_1053397145 -3 Left 1053397142 9:37785357-37785379 CCACTTAAGAGTTTCTTGGGATC 0: 1
1: 1
2: 2
3: 12
4: 104
Right 1053397145 9:37785377-37785399 ATCTCTGGAAGCTGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053397145 Original CRISPR ATCTCTGGAAGCTGAGCAGA GGG Intronic
No off target data available for this crispr