ID: 1053397455

View in Genome Browser
Species Human (GRCh38)
Location 9:37787308-37787330
Sequence GCCTAGGGCTCCCGCCGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053397455_1053397460 17 Left 1053397455 9:37787308-37787330 CCTAGGCGGCGGGAGCCCTAGGC 0: 1
1: 0
2: 2
3: 14
4: 145
Right 1053397460 9:37787348-37787370 AACCCGGCTTCAAGCCGTCGAGG No data
1053397455_1053397459 1 Left 1053397455 9:37787308-37787330 CCTAGGCGGCGGGAGCCCTAGGC 0: 1
1: 0
2: 2
3: 14
4: 145
Right 1053397459 9:37787332-37787354 GCGAACGAGTGTCTCGAACCCGG No data
1053397455_1053397466 30 Left 1053397455 9:37787308-37787330 CCTAGGCGGCGGGAGCCCTAGGC 0: 1
1: 0
2: 2
3: 14
4: 145
Right 1053397466 9:37787361-37787383 GCCGTCGAGGGCGCGCGGGTCGG No data
1053397455_1053397464 25 Left 1053397455 9:37787308-37787330 CCTAGGCGGCGGGAGCCCTAGGC 0: 1
1: 0
2: 2
3: 14
4: 145
Right 1053397464 9:37787356-37787378 TTCAAGCCGTCGAGGGCGCGCGG No data
1053397455_1053397465 26 Left 1053397455 9:37787308-37787330 CCTAGGCGGCGGGAGCCCTAGGC 0: 1
1: 0
2: 2
3: 14
4: 145
Right 1053397465 9:37787357-37787379 TCAAGCCGTCGAGGGCGCGCGGG No data
1053397455_1053397461 18 Left 1053397455 9:37787308-37787330 CCTAGGCGGCGGGAGCCCTAGGC 0: 1
1: 0
2: 2
3: 14
4: 145
Right 1053397461 9:37787349-37787371 ACCCGGCTTCAAGCCGTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053397455 Original CRISPR GCCTAGGGCTCCCGCCGCCT AGG (reversed) Intronic
900985643 1:6071636-6071658 GCGTAGGGCACCTGCCGCTTAGG + Intronic
902063101 1:13661740-13661762 GCGTAGGACTCCCTCCGACTGGG - Intergenic
903002898 1:20279058-20279080 GCCTGGGGCTGCCGCCAGCTGGG + Intergenic
903408895 1:23123258-23123280 ACCTCGGGATCCCCCCGCCTCGG - Intronic
904160291 1:28518123-28518145 GCCAAGGGCTCCCCCAGCCCGGG + Intronic
911723783 1:101220132-101220154 GCCTGGAGCTCCCGCCGCACTGG + Intergenic
913356540 1:117929170-117929192 CCCTAGGGCGCCCGCCTCCTTGG + Intronic
914813692 1:151047900-151047922 GCCTTGGGCCCCCGCCGCCCGGG - Exonic
920609224 1:207421463-207421485 GCCTATGTCTCCCTCGGCCTAGG - Intergenic
923182207 1:231530459-231530481 GCCTCGTGATCCCCCCGCCTCGG - Intronic
1066432012 10:35361088-35361110 GCCTTGTGATCCCCCCGCCTCGG + Intronic
1069842021 10:71345853-71345875 GCCAAGGGCTCCCCCCACCACGG - Intronic
1071514083 10:86285496-86285518 GCCCAGGGCCCCTGCCGACTGGG + Intronic
1075954267 10:126508651-126508673 GCCTAGGACTCAGGCCACCTGGG + Intronic
1076035623 10:127196573-127196595 GCCCGGGGCTCCGCCCGCCTCGG - Intronic
1076687575 10:132204969-132204991 CCCTGGGGCCCCCGCGGCCTCGG - Exonic
1079071629 11:17352406-17352428 ACCTAGTGATCCAGCCGCCTCGG + Intronic
1080642172 11:34164441-34164463 GCCTGGGCCTCCCGACGCCCAGG - Intronic
1081766628 11:45615764-45615786 GCCAAGGGCTCCAGCTCCCTGGG - Intergenic
1081812906 11:45923182-45923204 CCCCAGGACTCCCGCCGCCAGGG - Intronic
1083317965 11:61828038-61828060 CCCTCCGGCTCCCCCCGCCTCGG - Exonic
1083640883 11:64144648-64144670 GCCCTGGGCTCCCTCCTCCTCGG - Intronic
1083856158 11:65394079-65394101 ACCTGGAGCTCCCGCCGCTTTGG - Exonic
1084694546 11:70745757-70745779 CCCTAGGTCACCCGCCGCCTTGG + Intronic
1089772554 11:120814266-120814288 GCCTTGGGCTCCCAAGGCCTGGG - Intronic
1093057296 12:14567885-14567907 GCCTGGGGCCCACCCCGCCTAGG + Exonic
1097046265 12:56189563-56189585 GCCGCCGCCTCCCGCCGCCTGGG + Intronic
1103512949 12:121487741-121487763 GCCTAGGACTCCTCCCGTCTAGG + Intronic
1103623804 12:122204234-122204256 GCCTTGGGCGGCAGCCGCCTCGG - Intronic
1104947726 12:132424054-132424076 GCCTGGGGATCCCGCAGCCCAGG - Intergenic
1105779619 13:23695370-23695392 GCCCTGGGCGCCCGCCGGCTGGG - Intergenic
1116812895 14:49556258-49556280 GCCAAGAGATCCCCCCGCCTCGG - Intergenic
1125316865 15:38441315-38441337 CCCTTGGGCTCCCACTGCCTGGG - Intergenic
1127087020 15:55433375-55433397 GCCTGGGCCTCCGCCCGCCTGGG - Intronic
1127268019 15:57376639-57376661 CCCTGGGGGTCCCGCCGCCCTGG - Intronic
1127499306 15:59541814-59541836 ACCTGGGGATCCAGCCGCCTTGG + Intergenic
1129528623 15:76242066-76242088 ACCTCGGGATCCCCCCGCCTTGG + Intronic
1130853219 15:87818483-87818505 ACCTAGTGCTCCACCCGCCTCGG - Intergenic
1132302892 15:100787441-100787463 GGCTGTGGCTCCTGCCGCCTGGG + Intergenic
1132866953 16:2097816-2097838 GGCTGGGGGTCCTGCCGCCTTGG - Intronic
1133036378 16:3036335-3036357 GCCCAGGGCTCCCGTCCCCAGGG - Intronic
1133156347 16:3879796-3879818 GCCCCGGGCCCCCGCCGCCCCGG + Intronic
1134548086 16:15125639-15125661 GGCTGGGGGTCCTGCCGCCTTGG - Intronic
1134720267 16:16377086-16377108 GGCTGGGGGTCCTGCCGCCTTGG + Intergenic
1134947160 16:18334799-18334821 GGCTGGGGGTCCTGCCGCCTTGG - Exonic
1135065363 16:19305112-19305134 CCCCAGGTCTCCTGCCGCCTTGG - Intronic
1136514799 16:30761775-30761797 GCCCCGGGCTCCCGCCGCCTAGG + Exonic
1136927754 16:34389574-34389596 GCCTAGGGCCCCACCCGCCGAGG - Intergenic
1136976820 16:35022232-35022254 GCCTAGGGCCCCACCCGCCGAGG + Exonic
1138187076 16:54985062-54985084 GCCCAGGGCTCCAGCAGGCTGGG - Intergenic
1138360618 16:56424975-56424997 GCCTAGGGGCCCCTCCGCCAGGG - Intronic
1139472117 16:67183931-67183953 GGCGACGGCTCCCGCCGGCTGGG - Exonic
1139570451 16:67808341-67808363 ACCTAGTGATCCCCCCGCCTCGG - Intronic
1140224431 16:73066729-73066751 GCCCAGGGCCCACGCCGCCCAGG + Intergenic
1141964754 16:87434374-87434396 GCGTGGGGCTCCTGGCGCCTGGG - Intronic
1143030928 17:3966701-3966723 GCCTAGGGCTCCCGATCTCTGGG - Intergenic
1143443867 17:6996039-6996061 GCCCAGGGCTGCCGGCGCCTCGG - Intronic
1144725350 17:17499116-17499138 TCCCAGCACTCCCGCCGCCTGGG + Intergenic
1145126015 17:20300698-20300720 GCCCAGGCCTCCCGCAGCCGTGG + Intronic
1150108761 17:62479543-62479565 GCCGAGGCCTCCAGCTGCCTGGG - Intronic
1150250240 17:63700684-63700706 GCCGAGTCCTCCCGCCGCCAGGG + Intronic
1152689655 17:81712252-81712274 GCCTAGCGGTCCCGCCCCCGGGG + Intronic
1156460504 18:37319015-37319037 GCCTCTGGCTGCCCCCGCCTGGG + Intronic
1160025032 18:75209540-75209562 GCCCGGGGCTGCCGCCGGCTCGG - Intergenic
1160693528 19:471379-471401 ACCTCGGGATCCCCCCGCCTCGG + Intronic
1161614378 19:5261751-5261773 GCCTAGCTCTCCAGCCTCCTGGG + Intronic
1162747416 19:12806531-12806553 CCCTGGCGCTCCCGCCGCCGTGG - Intronic
1163298434 19:16427968-16427990 GCCTAGTGATCCACCCGCCTTGG - Intronic
1164964712 19:32472319-32472341 GGCTGGGGCTACCGCAGCCTGGG - Intronic
1164982912 19:32627817-32627839 GCCTAACGCTCCCGCAGGCTGGG - Intronic
1165829219 19:38722272-38722294 GCCTGGGCCTCCTGCTGCCTGGG - Intronic
1166068775 19:40375823-40375845 TCCTAGGGATCCTTCCGCCTCGG - Intronic
1166641938 19:44500734-44500756 GCCTCGGCCTCCCGGCGCCGCGG - Intergenic
1167269374 19:48498887-48498909 GCCCATGGCCCCCCCCGCCTCGG - Exonic
925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG + Intergenic
929258411 2:39838861-39838883 GCCTCAGGCTCCCACCACCTTGG - Intergenic
932558149 2:72843521-72843543 GCCTAGGGTTCCTGCCTGCTTGG + Intergenic
932621941 2:73269737-73269759 GCTCAGGGCGCCCGCGGCCTGGG + Exonic
933667053 2:84971838-84971860 GCCTAGCGCTCCCGCCGCCCCGG + Intronic
933715192 2:85354788-85354810 ACTTGGGGGTCCCGCCGCCTCGG - Exonic
933886145 2:86720523-86720545 GGCTAGTGCGCCCGCCGCCTCGG + Exonic
933924036 2:87076183-87076205 GGCTAGTGCGCCCGCCGCCTCGG - Intergenic
937826299 2:126371796-126371818 GCCTATGCCTCCCTCGGCCTAGG - Intergenic
937826629 2:126373898-126373920 GCCTATGCCTCCCTCGGCCTAGG + Intergenic
937870427 2:126782273-126782295 GCCTTGCGCTCCCGTCCCCTTGG - Intergenic
942116757 2:172735816-172735838 CCCGCGGGCTCCCGCGGCCTGGG - Intronic
944088751 2:195880569-195880591 TCCTAGTGATCCCCCCGCCTCGG + Intronic
947590618 2:231383144-231383166 GCCAAGGGCTCCAGCCGCAGTGG + Intergenic
947822372 2:233081070-233081092 GCCTAGGGCGCCCGCAGGTTTGG + Intronic
948428605 2:237903986-237904008 GCCTAGGCCTCCCCCAGCGTTGG + Intronic
948615213 2:239194031-239194053 GCCAAGGGCCCCCACCACCTGGG + Intronic
1175780028 20:61676451-61676473 GCCCGGGGCTCCCTCCTCCTGGG + Intronic
1175940147 20:62533995-62534017 GCCTGGGGCTCCCGCCCCTGTGG - Intergenic
1178453571 21:32727475-32727497 GCCCCGGGCTACCGCCGGCTGGG + Intronic
1181934535 22:26429348-26429370 GGCTCGGGCTCCCGCGGCGTGGG + Exonic
1183427223 22:37746383-37746405 GCCTCCTGCTCCCGCCGCCCTGG + Intronic
1184127819 22:42500422-42500444 GCCTAGGGGTGGGGCCGCCTAGG + Intergenic
1185028264 22:48427803-48427825 GCCGAGGGCTCCCGGCACCCTGG + Intergenic
1185345055 22:50307404-50307426 GCGGAGGGCTCCCGGGGCCTGGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
954162271 3:48731301-48731323 GCCTAGTGATCCACCCGCCTTGG - Intronic
956625425 3:71262032-71262054 ACCTCGTGATCCCGCCGCCTCGG - Intronic
961369691 3:126421945-126421967 GCCTAGGGCTCCCTCAGCCATGG + Intronic
963297147 3:143558489-143558511 GACTTGGGCTCCCACAGCCTTGG - Intronic
967638206 3:191830543-191830565 GCCTCGTGCTCCACCCGCCTTGG - Intergenic
968230475 3:197002555-197002577 GCCTCGGGAGCCCGCGGCCTGGG + Exonic
968487076 4:867896-867918 GCCTGTGGCTCTCTCCGCCTGGG + Intronic
969355576 4:6623406-6623428 GCCTAGGGCTCCCAGCGTGTTGG - Intergenic
971776315 4:30970524-30970546 ACCTAGTGATCCCCCCGCCTCGG + Intronic
972479817 4:39486615-39486637 GCCAAGGGCTGCCGCACCCTGGG + Intergenic
976102263 4:81578306-81578328 ACCTAGGGCTCCTCCAGCCTGGG + Intronic
984964355 4:185127808-185127830 GGCTGGGGCTCCAGTCGCCTGGG + Intergenic
985764134 5:1768039-1768061 GCCCAGGGCTCCCTCAGCCCAGG - Intergenic
987856447 5:23425180-23425202 GCCTATGTCTCCCTCAGCCTAGG + Intergenic
990996271 5:61735169-61735191 CCCTATGGCTCCCGCTTCCTAGG + Intronic
992042436 5:72848713-72848735 GCGTGGGGCTCACGCCGCCAAGG + Intronic
992088894 5:73300823-73300845 GCCTAGGGCTCTCTTTGCCTGGG + Intergenic
996379003 5:122845415-122845437 GCGCAGGGCTCCAGGCGCCTGGG - Intronic
997659644 5:135579389-135579411 GCCTGGGTCTCCCGCCGGCTCGG - Intergenic
998143151 5:139711048-139711070 GGGAAGCGCTCCCGCCGCCTGGG - Intergenic
1002281118 5:178130746-178130768 GCCAGGGGCTTCCGCCGACTGGG + Intergenic
1002911875 6:1497095-1497117 ACCTAGGACTCCAGCCTCCTTGG - Intergenic
1003886543 6:10526633-10526655 GCCTCGAGCTCCTCCCGCCTTGG + Intronic
1006097472 6:31665180-31665202 TCCTAGTGCTCGCGCCACCTGGG - Intronic
1006441367 6:34055717-34055739 CCCTAGGGCCCCCGCCCCCTAGG - Intronic
1006820059 6:36885991-36886013 CCCTCGGGCTCCTCCCGCCTCGG - Exonic
1007463432 6:42034709-42034731 ACCTAGTGATCCGGCCGCCTCGG + Intronic
1008678325 6:53844969-53844991 ACCTAGTGATCCCCCCGCCTTGG - Intronic
1008856901 6:56099467-56099489 GCCTCGTGATCCAGCCGCCTCGG + Intronic
1011195300 6:84774255-84774277 GCCTTGGGCGCCCGCCGCTTTGG + Intergenic
1017695597 6:157012618-157012640 GCCTAGGTCTCTTGCCCCCTGGG - Intronic
1018374196 6:163195629-163195651 CCCCAGGGCTCCCTGCGCCTCGG + Intronic
1020262079 7:6536359-6536381 GTCCAGGGCTCCCGCTGCCCAGG + Intronic
1022113790 7:27246284-27246306 GCCCCGGGCTGCCGCCGCCTCGG + Exonic
1022496274 7:30854987-30855009 GCCTGGGGCTCCCGATGCCCCGG - Intronic
1024707716 7:51979270-51979292 GCCTGGGGCTCATGCAGCCTGGG - Intergenic
1026946834 7:74321699-74321721 GCCTTGTGATCCCCCCGCCTTGG + Intronic
1031306028 7:120129288-120129310 GCCTAGAGATCCGCCCGCCTTGG + Intergenic
1032075492 7:128833928-128833950 GGCTGGGGCTCTGGCCGCCTGGG - Intronic
1033477117 7:141701993-141702015 TCCTCGGGCTCCCGCCTCCGGGG + Exonic
1034494301 7:151410602-151410624 GCCGCGGGCTCCCTCGGCCTGGG + Intronic
1035379890 7:158431154-158431176 GCCTGGGGCTCACGCTGGCTGGG - Intronic
1035619443 8:1026400-1026422 GACGAGGACGCCCGCCGCCTTGG + Intergenic
1037999893 8:23382604-23382626 GAATAGGGCTCCCACCTCCTGGG - Intronic
1039737800 8:40351126-40351148 GCCTAGTGATCCACCCGCCTTGG + Intergenic
1042146886 8:65739044-65739066 GCCCAGGGCTCCAGCGGCCTGGG + Intronic
1044006242 8:86940414-86940436 GCCTCGGCCTCCCTCGGCCTGGG + Intronic
1045516373 8:102863898-102863920 GCCTATGGCCCAGGCCGCCTTGG - Exonic
1050651960 9:7786037-7786059 GCCTATGTCTCCCTCGGCCTAGG - Intergenic
1051620970 9:19049273-19049295 TCTTAGGGCTCACGCCGCCCCGG + Intronic
1053397455 9:37787308-37787330 GCCTAGGGCTCCCGCCGCCTAGG - Intronic
1055547684 9:77397220-77397242 GCCTTGGGATCCGCCCGCCTCGG + Intronic
1055611952 9:78032168-78032190 GCCTACTGCTCCCGCACCCTCGG + Intergenic
1059404807 9:114093081-114093103 GCCTAGGGCTCCCTCTGCCCTGG - Intronic
1060979989 9:127786254-127786276 GCCCAGGGCTCCCGGCCCCGAGG - Intronic
1061822777 9:133237939-133237961 GCCTGGGCCTCACGCAGCCTGGG + Intergenic
1061991744 9:134163182-134163204 GCCTGCGCCTCCCGCAGCCTTGG + Intergenic
1062014295 9:134283505-134283527 GCGTGGGGCTCCTGCCTCCTTGG + Intergenic
1062601064 9:137318790-137318812 GCCCAGGAGTCCCACCGCCTGGG + Intronic
1192499775 X:71642537-71642559 GCCTAGTGATCCGCCCGCCTTGG + Intergenic
1198829120 X:140730106-140730128 ACCTAGTGATCCCCCCGCCTCGG + Intergenic
1200226325 X:154419805-154419827 GCCCCTGGCTCCCGCCCCCTCGG + Intronic