ID: 1053399029

View in Genome Browser
Species Human (GRCh38)
Location 9:37801137-37801159
Sequence GGCCGCCGGCACGGAGGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 15, 3: 35, 4: 235}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053399029_1053399043 5 Left 1053399029 9:37801137-37801159 CCCTCCCCTCCGTGCCGGCGGCC 0: 1
1: 0
2: 15
3: 35
4: 235
Right 1053399043 9:37801165-37801187 CAGACTGCAGGGCCAAGAGCCGG 0: 1
1: 0
2: 7
3: 26
4: 457
1053399029_1053399046 16 Left 1053399029 9:37801137-37801159 CCCTCCCCTCCGTGCCGGCGGCC 0: 1
1: 0
2: 15
3: 35
4: 235
Right 1053399046 9:37801176-37801198 GCCAAGAGCCGGGGCCGACACGG 0: 1
1: 0
2: 0
3: 10
4: 110
1053399029_1053399050 27 Left 1053399029 9:37801137-37801159 CCCTCCCCTCCGTGCCGGCGGCC 0: 1
1: 0
2: 15
3: 35
4: 235
Right 1053399050 9:37801187-37801209 GGGCCGACACGGCCTCGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 87
1053399029_1053399045 7 Left 1053399029 9:37801137-37801159 CCCTCCCCTCCGTGCCGGCGGCC 0: 1
1: 0
2: 15
3: 35
4: 235
Right 1053399045 9:37801167-37801189 GACTGCAGGGCCAAGAGCCGGGG 0: 1
1: 0
2: 0
3: 19
4: 252
1053399029_1053399051 28 Left 1053399029 9:37801137-37801159 CCCTCCCCTCCGTGCCGGCGGCC 0: 1
1: 0
2: 15
3: 35
4: 235
Right 1053399051 9:37801188-37801210 GGCCGACACGGCCTCGGCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 111
1053399029_1053399039 -6 Left 1053399029 9:37801137-37801159 CCCTCCCCTCCGTGCCGGCGGCC 0: 1
1: 0
2: 15
3: 35
4: 235
Right 1053399039 9:37801154-37801176 GCGGCCCGGGCCAGACTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 167
1053399029_1053399044 6 Left 1053399029 9:37801137-37801159 CCCTCCCCTCCGTGCCGGCGGCC 0: 1
1: 0
2: 15
3: 35
4: 235
Right 1053399044 9:37801166-37801188 AGACTGCAGGGCCAAGAGCCGGG 0: 1
1: 0
2: 4
3: 41
4: 384
1053399029_1053399048 22 Left 1053399029 9:37801137-37801159 CCCTCCCCTCCGTGCCGGCGGCC 0: 1
1: 0
2: 15
3: 35
4: 235
Right 1053399048 9:37801182-37801204 AGCCGGGGCCGACACGGCCTCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1053399029_1053399038 -7 Left 1053399029 9:37801137-37801159 CCCTCCCCTCCGTGCCGGCGGCC 0: 1
1: 0
2: 15
3: 35
4: 235
Right 1053399038 9:37801153-37801175 GGCGGCCCGGGCCAGACTGCAGG 0: 1
1: 0
2: 3
3: 16
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053399029 Original CRISPR GGCCGCCGGCACGGAGGGGA GGG (reversed) Exonic
900205022 1:1427946-1427968 CGCCCCCGCCACGGAGGGCAGGG + Intergenic
900797798 1:4719828-4719850 GGACACCGGCAGGGAGGGAAGGG - Intronic
901508420 1:9701204-9701226 GGTGGTGGGCACGGAGGGGAGGG - Intronic
901678904 1:10901994-10902016 GTCCTCAGGCACGGAAGGGAGGG - Intergenic
903413785 1:23168149-23168171 GGCCGCGGGCCGGGCGGGGAGGG - Intronic
903462783 1:23530939-23530961 GGCCGCGGGCCAGGAGGGGAGGG - Exonic
903750408 1:25617475-25617497 GGGCCCCGGCGCGGCGGGGAGGG + Exonic
903875942 1:26472934-26472956 GCCCGCCCGCAGGGAGGGGAGGG - Intronic
904031649 1:27536952-27536974 GGCCGCAGGCACCGCGGGAATGG - Intronic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
915098125 1:153478456-153478478 GGCCCCGGGCATGGAGGGGTGGG + Intergenic
916379078 1:164188680-164188702 GGGGGCCTGCAGGGAGGGGAAGG - Intergenic
919830801 1:201539074-201539096 GGCCGCCGTTCCCGAGGGGACGG + Intergenic
919919594 1:202160248-202160270 GGCAGCAGGGACGGAGGTGAGGG + Intronic
921023699 1:211259216-211259238 GGCCGCCTGGGGGGAGGGGAAGG - Intronic
922100557 1:222474335-222474357 GGCCGCCAACAGGGAGGGGATGG + Intergenic
922734073 1:227970341-227970363 GGCCGCCGACAGGCAGGGGATGG - Intergenic
923337205 1:232980759-232980781 GGCTGCGTGCAGGGAGGGGACGG - Exonic
923506496 1:234609890-234609912 GGCGGCCGGCACGGAGTGCGGGG + Intergenic
924198953 1:241640182-241640204 GGCCGCGGGCGCTGAGGGGCCGG - Exonic
1062951272 10:1505689-1505711 GGCGGCTGCCACGGTGGGGACGG - Intronic
1065099633 10:22320943-22320965 GGCGCGCGGCGCGGAGGGGAGGG + Intronic
1069624723 10:69860697-69860719 GGCCACAGGCAAGGAGGGCATGG - Intronic
1069774633 10:70919274-70919296 GGCAGCAGGCAGTGAGGGGAAGG + Intergenic
1069910230 10:71754331-71754353 GGCCCCCGGGAATGAGGGGAGGG + Intronic
1070179232 10:73998335-73998357 GGCCGCCTGCACGGCGGCCACGG - Exonic
1070340700 10:75495597-75495619 GCCCGCAGGCAAGAAGGGGAGGG - Intronic
1070570682 10:77637850-77637872 CGCCGCCCGCCCGGGGGGGAGGG + Intronic
1071527520 10:86366841-86366863 GGAGGCGGGCAGGGAGGGGAGGG - Intergenic
1071633189 10:87231931-87231953 GGCCGAGGGCAGGGATGGGAGGG - Intronic
1071646638 10:87364149-87364171 GGCCGAGGGCAGGGATGGGAGGG - Intronic
1072253623 10:93600852-93600874 GGCCGCGGGGAGGGCGGGGATGG + Intronic
1075501719 10:122980692-122980714 GGCGGTCAGCACGGAGGGGCGGG + Exonic
1076853296 10:133103476-133103498 GGCCGCCGGGGCGGCGGGGGAGG - Intronic
1076981872 11:208960-208982 GGGGGCGGGCACGGAGGGGGTGG + Intronic
1077111103 11:862626-862648 GGCAGCCGACAGGGACGGGAAGG - Exonic
1077185772 11:1234748-1234770 GGCAGCGGGCAGGGAGGGCAGGG + Intronic
1077350047 11:2088931-2088953 GGCAGTCGGCCCGGAGGGCAGGG + Intergenic
1077459354 11:2700831-2700853 CGCCAGCGGCGCGGAGGGGACGG - Intronic
1078210380 11:9265283-9265305 CGGCGGCGGCGCGGAGGGGAAGG - Exonic
1079136941 11:17780755-17780777 GGCAGCCCGCACGGAGACGAGGG + Intronic
1081672819 11:44950976-44950998 GGCCGCCGGGGCGGGCGGGATGG + Intronic
1082076594 11:47980402-47980424 CGCGGCCGGCTCGGAGGGGGCGG + Intergenic
1083623148 11:64058830-64058852 GGCAGCCGGCAAGGGGGGGTAGG + Intronic
1084028442 11:66467032-66467054 GGCCGCCGGGGCGGAGGGGGCGG + Intronic
1084129165 11:67119707-67119729 GGCCGAGGGCACGGCGAGGAGGG + Exonic
1084213406 11:67634162-67634184 GGCCGGGGCCACGGTGGGGACGG - Intronic
1084396855 11:68916741-68916763 GGCCGCCTGCTGGGAGGGGGAGG + Intronic
1084546229 11:69816452-69816474 CGCCGCCCCCACGGAGGGGGCGG + Intronic
1084716467 11:70877432-70877454 GGCAGCCAGCAGGCAGGGGAAGG - Intronic
1085296214 11:75433213-75433235 GGACGCCAGGAGGGAGGGGAAGG + Intergenic
1085666076 11:78417148-78417170 GGCCGGCGGCCGGGAGGGGCAGG + Intronic
1089493570 11:118897869-118897891 AGCCGCCTGCAGGGAGGGGTGGG + Exonic
1089533833 11:119149165-119149187 GGCCCTCGGCTCGGAGGAGACGG - Exonic
1090198889 11:124839825-124839847 GGCCGCGGGGCGGGAGGGGAAGG - Intergenic
1090805140 11:130197981-130198003 GGACGCGGGCAGGGTGGGGAAGG - Intronic
1091225875 11:133956349-133956371 GGCCGCCGGGCAGGAGGCGACGG + Intronic
1091327473 11:134701800-134701822 GGCCGCCAGGACCCAGGGGAAGG - Intergenic
1092112194 12:5971567-5971589 GGCCCCCGGGACGGGGAGGAGGG - Intronic
1096548283 12:52356273-52356295 GGGCGCCGGGAGGGACGGGAGGG - Intergenic
1098161098 12:67648838-67648860 GGCCCGCGGCGCGCAGGGGAGGG + Exonic
1100477558 12:94948537-94948559 GGCCTCAGGCAGAGAGGGGAAGG + Intronic
1100613911 12:96216026-96216048 GACCTCTGGCACAGAGGGGAGGG - Intronic
1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG + Exonic
1102768270 12:115451858-115451880 GGCCGCCTGCAGGGAGAGGCGGG - Intergenic
1104544441 12:129698611-129698633 GGGAGACGGCATGGAGGGGAGGG + Intronic
1104856278 12:131903862-131903884 GGCTGCCAGCACAGTGGGGAGGG + Intronic
1104962772 12:132495997-132496019 AGCAGCCGGGAGGGAGGGGATGG - Intronic
1106720034 13:32427658-32427680 GGGCGCGGGCACGGAGAGGAGGG - Intronic
1107654088 13:42574237-42574259 GGCCGCAGACAAGAAGGGGAGGG + Exonic
1113985811 13:114314707-114314729 GGCCGCCGACCTGGCGGGGACGG + Intronic
1114255320 14:20996695-20996717 GCCCGCCGGCACGGCAGGTATGG + Exonic
1119429190 14:74554958-74554980 GGCCTCGGGAAAGGAGGGGAGGG + Intronic
1122017665 14:98809914-98809936 GGGAGCCGGTACGGAGGTGAAGG - Intergenic
1122843514 14:104478000-104478022 GGCCGCCGCCTCTGAGTGGAGGG - Intronic
1123110515 14:105864932-105864954 GGCCGAGGGCAGGGACGGGAAGG - Intergenic
1124515114 15:30361222-30361244 GGCAGGCGCCAGGGAGGGGATGG - Intronic
1124727808 15:32169505-32169527 GGCAGGCGCCAGGGAGGGGATGG + Intronic
1125744326 15:41988363-41988385 GTCTCCCGGCACTGAGGGGAGGG - Intronic
1128089769 15:64911712-64911734 GGCCTCGGGCGCGGAGGGGTGGG + Intronic
1130348003 15:83066855-83066877 GGCCGCCAGCACGAAGCGGTGGG + Exonic
1131132284 15:89908070-89908092 GGCCCCTGGAATGGAGGGGAGGG + Intronic
1131187903 15:90291678-90291700 GGCCGCCCACTCAGAGGGGAGGG - Intronic
1132663771 16:1072735-1072757 GGGCGCCGGCTGGGAGGGGGCGG - Intergenic
1132690939 16:1181531-1181553 TCCCGCAGGCACGGAGAGGAGGG + Intronic
1132889425 16:2196594-2196616 GGCTCCCGGCGCGGAGGGGGCGG + Intergenic
1132983898 16:2753367-2753389 GGCCCCCGGCGCTGCGGGGAGGG + Intronic
1133213104 16:4273779-4273801 GGGCCCCGGCAGGGAGGGGAGGG + Intergenic
1136287370 16:29252447-29252469 GCCCGTAGGCACTGAGGGGAAGG - Intergenic
1136605765 16:31332250-31332272 GGCCGCAGGCTCGCAGGCGACGG - Exonic
1139446235 16:67000414-67000436 GGCGCCGGGCAGGGAGGGGATGG + Intronic
1139593755 16:67946865-67946887 TGCAGCTGGCACGGAGGGGAGGG - Intronic
1141601735 16:85130831-85130853 GGCAGCCAGGACGGAGGGGCGGG + Intergenic
1141682619 16:85553371-85553393 GGCCGCCGGCGCCGAGGGCCTGG + Intergenic
1142090377 16:88206806-88206828 GGCCGTGGGGACGGAGGGGAGGG + Intergenic
1142090389 16:88206831-88206853 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090401 16:88206856-88206878 GGCCGCGGGGACGGAGGGGGAGG + Intergenic
1142090414 16:88206882-88206904 GGCCGCGGGGACGGAGGGGGAGG + Intergenic
1142090427 16:88206908-88206930 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090438 16:88206932-88206954 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090450 16:88206957-88206979 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090462 16:88206982-88207004 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090474 16:88207007-88207029 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090486 16:88207032-88207054 GGCCGCGGGGACGGAGGGGGAGG + Intergenic
1142090499 16:88207058-88207080 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090511 16:88207083-88207105 GGCCGCGGGGACGGAGGGGGAGG + Intergenic
1142090536 16:88207135-88207157 GGCCGCGGGGACAGAGGGGAGGG + Intergenic
1142090547 16:88207159-88207181 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090559 16:88207184-88207206 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090584 16:88207235-88207257 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090609 16:88207286-88207308 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090621 16:88207311-88207333 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090646 16:88207362-88207384 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090658 16:88207387-88207409 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142092984 16:88225076-88225098 GCCCGTAGGCACTGAGGGGAAGG - Intergenic
1142115445 16:88353886-88353908 GGCCAACAGCAGGGAGGGGAGGG - Intergenic
1143078626 17:4365929-4365951 GGCCGCCAGCTTGGAGGGGCGGG - Intronic
1143642970 17:8210148-8210170 GGGCGCAGGGACGGAGGGAAGGG + Intronic
1146763259 17:35496508-35496530 GGCCGGAGGGACGGTGGGGAGGG - Intronic
1146909345 17:36638586-36638608 GGGAGCCGGCATGGAGTGGAGGG - Intergenic
1147891521 17:43720763-43720785 GGCTGCCAGCACGGAGGCGGAGG - Intergenic
1148830164 17:50426063-50426085 GGCCGCGGGGTCGGAGGGGAAGG + Intergenic
1149296281 17:55265041-55265063 GGCCGCCGGCGCGGGGAGGGGGG + Exonic
1150286855 17:63959526-63959548 GGCTGCGGGGGCGGAGGGGAAGG + Intronic
1150373518 17:64661908-64661930 GGCGGGCGGCACGGGGGCGACGG + Exonic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1151919064 17:77140598-77140620 GGCTGCCGGCGTGCAGGGGAGGG - Intronic
1151979129 17:77498613-77498635 GGCCAACGGCATGGAGGAGAAGG + Exonic
1152070424 17:78131441-78131463 CGACGCCGGCGCAGAGGGGACGG + Exonic
1152424460 17:80211373-80211395 GGCCGCGAGCTCGGAGGGAAAGG + Intronic
1152512452 17:80799710-80799732 GGCGGCCGCCAGGGAGGGGAGGG - Intronic
1152606688 17:81295026-81295048 GGACGCCGGTGGGGAGGGGATGG + Exonic
1152732167 17:81977753-81977775 GGCCGCCCGCCCGGGGCGGACGG + Intronic
1154246246 18:12702418-12702440 GGCCGCCGGGCAGGAGGGAAAGG + Exonic
1157557285 18:48621270-48621292 GGAAGCTGGCATGGAGGGGAGGG + Intronic
1157662746 18:49460246-49460268 GCCCGCGGGCAGGGAAGGGAGGG + Intronic
1159040561 18:63319994-63320016 GGCCGCCGGCAGGGAGGGCCCGG + Exonic
1159040601 18:63320103-63320125 GGCAGGCGGCGCGGAGGGGCGGG + Exonic
1160765669 19:806450-806472 TGCCGCCGCCGCCGAGGGGATGG - Exonic
1161022109 19:2015472-2015494 GGCCGCGGGCGCGGAGCGGGCGG - Exonic
1161397319 19:4051722-4051744 GGCCGGGGTCACAGAGGGGATGG + Intronic
1161401145 19:4066640-4066662 GGCCCCCGGCACGGGGTGCAGGG - Intronic
1161680313 19:5676810-5676832 GGCCGCCTGGATGGAGGGGAGGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162315607 19:9936480-9936502 GGCCGCCGGCGAGGCGGGGGAGG - Exonic
1163035183 19:14565693-14565715 GGCTGCCGGCCCGGAGGGGCAGG - Intronic
1164594940 19:29526438-29526460 GGCCGCCGGCGGCCAGGGGAGGG + Intergenic
1165427866 19:35755710-35755732 CGCCGCCGGGCCGGAGGGGCGGG - Intronic
1166568480 19:43779356-43779378 GGCGGCGGGCACTGAGGGGGTGG - Intronic
1166791000 19:45398334-45398356 GGGCGCCTGCATGGTGGGGAGGG + Exonic
1167659187 19:50786028-50786050 GGCAGAGGGCAGGGAGGGGAAGG - Intergenic
1168071943 19:53958411-53958433 GGCGGCCGGAAATGAGGGGAGGG - Intergenic
1168714160 19:58517515-58517537 GGCCGCCAGCACGCAGCGGTGGG + Exonic
926310237 2:11669694-11669716 GGCTGCGGGCACGCAGGGGCTGG + Exonic
927141386 2:20133373-20133395 GGCAGCAGGCAAGGAGGGGTGGG - Intergenic
927210455 2:20635993-20636015 CGCCGCGGCCACGGCGGGGAAGG + Intronic
927848042 2:26481390-26481412 GGCCTTCAGCAAGGAGGGGAGGG - Intronic
928374805 2:30765563-30765585 GGCCAAGGGCAGGGAGGGGAAGG - Intronic
930096771 2:47571440-47571462 GGCCGCCCGCTCGGTCGGGAGGG - Intergenic
932611407 2:73202839-73202861 GGCCGCCGGCGCGCAGGGGTCGG - Exonic
936077693 2:109412117-109412139 GGATGCCGGCACAGATGGGATGG + Intronic
937221714 2:120346012-120346034 TGCCGCCGGCTCGCAGGGGGAGG - Intergenic
937368857 2:121284540-121284562 GGCGGCGGGCTCGGAGGGGCAGG - Intronic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
944221682 2:197310288-197310310 GGCCGCGGGCCCGGCGGGGCTGG - Intronic
947447892 2:230178683-230178705 GGTGGCTGGCACTGAGGGGATGG + Intronic
948035915 2:234858176-234858198 AGCCTCCGGCAGGGAGGGGTTGG - Intergenic
948061343 2:235045014-235045036 GGTCACCTGCAGGGAGGGGATGG + Intronic
1168886851 20:1266275-1266297 GGCTGCCGGGAGGGAGGGGCGGG - Intronic
1169195392 20:3679882-3679904 GGCCGCCAGTGCAGAGGGGAAGG + Intronic
1169266878 20:4172382-4172404 GGCCGCCTGCACGGGGCGGGCGG - Intronic
1172275095 20:33674893-33674915 GGCCAGAGTCACGGAGGGGAGGG - Intergenic
1173812096 20:45962236-45962258 GGCCACAGGCATGGTGGGGACGG - Intronic
1175521663 20:59605663-59605685 AGCCGCCGGCAGGGAGACGAAGG + Intronic
1175825465 20:61934298-61934320 AGCCGCCGGCACTGTGGAGATGG - Intronic
1175960093 20:62631524-62631546 GGCAGCCGGCTCGGTGGGGTGGG + Intergenic
1175997064 20:62816691-62816713 GGCCGCCTTCAGGGAGGGGCAGG - Intronic
1178544123 21:33479464-33479486 CGCGGCGGGCACGGAGGCGACGG - Intronic
1178914581 21:36699390-36699412 GGCGGCCGGCGCGGAGGCGGAGG - Exonic
1178915907 21:36705458-36705480 GGCCGCAGGCAGGGAAGGGGTGG + Intronic
1179054346 21:37916952-37916974 AGCGGCCGGGACGGAGGGGAGGG + Intergenic
1179708211 21:43194603-43194625 GGCTGCCGGCATGGAGGTCAAGG - Intergenic
1179991553 21:44950793-44950815 GGACGCCGGCAAGGAGGTGCAGG - Intronic
1180874610 22:19169379-19169401 GGCAGCCGGAACAGTGGGGAGGG + Intergenic
1181162046 22:20965147-20965169 GGCCGCGGGCGCGGGGGGGCGGG - Exonic
1183063736 22:35350100-35350122 GGCCGGGGGCATGGAGGGGAGGG + Intergenic
1183961426 22:41413875-41413897 GGCGGCCGGCACGGCGGGCGCGG + Intergenic
1184737867 22:46409714-46409736 GGCCGCCGTGACCGGGGGGATGG + Intronic
1184981198 22:48097083-48097105 GGCTGCAGGCATGGAGGGGCAGG - Intergenic
1185004836 22:48269863-48269885 GGCCATGAGCACGGAGGGGAAGG + Intergenic
950729856 3:14947830-14947852 GGCCCCCGGCGCGGAGGGCAGGG - Intronic
950729927 3:14948072-14948094 GGCCGCGGGCGGGGAGGGGAGGG - Intronic
951543660 3:23806182-23806204 GGCCGCCGGGCCGCAGGGCACGG + Intronic
952316703 3:32238495-32238517 GGCGGGCGGCGCGGAGGAGAGGG - Intergenic
952706191 3:36380402-36380424 GGCCGCGGGCGCGGCGGGGCGGG + Exonic
953772305 3:45787192-45787214 GGCCAGCGGCAGGGAAGGGAAGG - Intronic
954392619 3:50275479-50275501 GGCCGCCGGGAGGGAGGCGAAGG + Intronic
954553292 3:51499735-51499757 GGCCGCCGGCGAGGAGGGGGCGG - Intronic
955045419 3:55354940-55354962 GGCAGCAGGCAGGAAGGGGAAGG - Intergenic
960628337 3:119702999-119703021 GGCCGCCGGCGCGCAGGGATAGG - Intergenic
961603227 3:128076385-128076407 GGCGGCCGGCATGGAGAGGCGGG + Intronic
962826016 3:139101572-139101594 GGCCACCTGCAGAGAGGGGAGGG + Intronic
967904143 3:194486922-194486944 GGGCGCCGCCGCGGAGGGGAGGG - Intronic
968392898 4:207356-207378 GGCCAGAGGCAGGGAGGGGAGGG - Intergenic
969262471 4:6042870-6042892 GGGCGCAGGCACGGAGAGTACGG + Intronic
971432607 4:26584137-26584159 GGCCGCCGGCGCGGAGCGAACGG - Exonic
972765787 4:42151690-42151712 GGCCGCCGGCACCGGCGGCACGG - Exonic
973613706 4:52659377-52659399 GGCCGGCGGCGCGGGGAGGAGGG + Intergenic
979259237 4:118633241-118633263 GGCCGCCGACAGGCAGGGGATGG - Intergenic
979329109 4:119407318-119407340 GGCCGCCGACAGGCAGGGAATGG + Intergenic
980970137 4:139559862-139559884 GCCCGCTGGCAGGGAGTGGAGGG + Intronic
984206541 4:176793047-176793069 GGCCGCCGGGGAGGAGGCGAGGG - Intergenic
985884718 5:2668671-2668693 GGGCGCCGGGGAGGAGGGGAAGG + Intergenic
986206188 5:5627459-5627481 GGCTGCAGCCACGGAGGGGCAGG + Intergenic
986337534 5:6766638-6766660 GGCTGCAGGCTTGGAGGGGAAGG - Intergenic
997013763 5:129906235-129906257 GCGCGCTGGCACGGTGGGGATGG - Intronic
998157733 5:139796002-139796024 GGCCGCCAGCGGGGAGGGGCGGG - Intronic
999318819 5:150601010-150601032 GGCGGGCGGGAGGGAGGGGAGGG - Intergenic
1001381590 5:171309694-171309716 GACCGTGGGCACGGAGGGCATGG - Exonic
1005303777 6:24495065-24495087 GGCCGCCGGCGCGGGGGCGGAGG - Exonic
1006333998 6:33411065-33411087 AGCCGCCGGGACGGAGGGGCTGG + Exonic
1006417052 6:33910870-33910892 GGCAGCAGGTAGGGAGGGGAGGG - Intergenic
1006509605 6:34514958-34514980 GCCCGCCACCACGGAGGAGAAGG + Intronic
1008760403 6:54846723-54846745 GGGCGCGGGCAGGGAGGGGAGGG - Intergenic
1011517376 6:88167456-88167478 GGCCCCGGGGGCGGAGGGGAGGG - Intergenic
1012410131 6:98947649-98947671 GGCCGCGGGCGGGGAGGGGCGGG + Intronic
1013565424 6:111354920-111354942 GGCAAGGGGCACGGAGGGGAAGG + Intronic
1017672364 6:156779108-156779130 GGCCGCCGGCTCGGCGGCGGGGG + Exonic
1017764015 6:157592671-157592693 TGCCGCCTACAGGGAGGGGAGGG + Intronic
1017769191 6:157631935-157631957 GGCCGTGGGCACAGAGGGAAAGG + Intronic
1017954945 6:159169679-159169701 GGCCGCCGCCGAGGAGGCGACGG - Exonic
1019341598 7:511236-511258 GGCCAGTGGCTCGGAGGGGAGGG + Intronic
1019358732 7:594262-594284 GGCCTCGGGCATGGAGTGGAGGG + Intronic
1020107789 7:5430182-5430204 GGGAGCCGGCAGGGAGGGGGTGG - Intergenic
1020182888 7:5935905-5935927 AGCCGCCAGCAAGCAGGGGAGGG - Intronic
1020300024 7:6788852-6788874 AGCCGCCAGCAAGCAGGGGAGGG + Intronic
1021573886 7:22090525-22090547 GGCCCCAGGCAGTGAGGGGAAGG + Intergenic
1022837392 7:34131107-34131129 GGAAGCTGGCATGGAGGGGAAGG + Intronic
1023355025 7:39357792-39357814 TGCAGGTGGCACGGAGGGGAAGG + Intronic
1024074147 7:45810287-45810309 GGCCGCCGACAGGCAGGGGCTGG - Intergenic
1025131367 7:56375714-56375736 GGCCGCCGACAGGCAGGGGCTGG + Intergenic
1027187235 7:75979810-75979832 GGCAGCCGGCACTCAGGGGAGGG - Intronic
1027361758 7:77416486-77416508 GGCCGCCGGCCGGGAGGAGCTGG - Intergenic
1030347891 7:108455048-108455070 GGCCGCGGGCGCGGGCGGGAGGG + Intronic
1033033139 7:137846520-137846542 GGCCGCCGGCCAGAAGGAGAAGG - Exonic
1033899433 7:146116854-146116876 CGCCGCCGGCCGGGAGGCGAAGG + Exonic
1034951307 7:155298413-155298435 GGCCGCCAGCAGGGAGGGCCCGG - Exonic
1035260638 7:157659382-157659404 GGCCGCGGGGATGGGGGGGATGG + Intronic
1035476056 7:159144917-159144939 AGCTGCCGGGACGGAGGGGGCGG - Exonic
1035676528 8:1460495-1460517 GGCAGCCGTGACAGAGGGGAAGG - Intergenic
1039542295 8:38382211-38382233 GGCGGCCAGCACGGAGGCGGAGG - Exonic
1040304234 8:46203721-46203743 GGCCGCAGGAACTCAGGGGATGG + Intergenic
1042278359 8:67028652-67028674 GGCCGCCGCCTCACAGGGGAAGG - Intronic
1044698914 8:94949193-94949215 GGCCGCCGGCTCGGCGGGGAAGG + Exonic
1044973778 8:97644341-97644363 GGCCGCTGCCACCGCGGGGAGGG - Exonic
1045583116 8:103500431-103500453 GCGCGCCGCCTCGGAGGGGAAGG - Intergenic
1049552501 8:143267096-143267118 GGCCGCGGGCAGCGTGGGGACGG + Intronic
1050151458 9:2622400-2622422 AGGCGCCACCACGGAGGGGAGGG - Intronic
1053351777 9:37418017-37418039 GGCCCCCGGAACCGAGGGGCAGG - Intergenic
1053399029 9:37801137-37801159 GGCCGCCGGCACGGAGGGGAGGG - Exonic
1053589150 9:39493191-39493213 TGCCCCCTGCAGGGAGGGGAAGG + Intergenic
1054577148 9:66872104-66872126 TGCCCCCTGCAGGGAGGGGAAGG - Intronic
1056796111 9:89659967-89659989 GGCCGGCTGCAGTGAGGGGAGGG - Intergenic
1058699338 9:107587864-107587886 GGCCGCCCGCACGGAAGGGCCGG - Intergenic
1059455526 9:114398081-114398103 GGCTGGTGGCAGGGAGGGGAGGG - Intergenic
1060008666 9:120024127-120024149 GGCAGCAGGCTGGGAGGGGATGG + Intergenic
1060102949 9:120856408-120856430 GGCCGCCAGCAGGAAGGCGAAGG - Exonic
1060113203 9:120921077-120921099 GGAAGCCAGCAGGGAGGGGAGGG + Intronic
1060424593 9:123493782-123493804 GGCTGCCAGGGCGGAGGGGAAGG + Intronic
1060820401 9:126658417-126658439 GGCAGGCGGCAGGGAGGGCAGGG - Intronic
1060932174 9:127496105-127496127 AGCCGTCTGCATGGAGGGGAGGG + Intronic
1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG + Exonic
1061365786 9:130172095-130172117 GGCCCCCGCCGCGGCGGGGAGGG - Intergenic
1062276610 9:135734293-135734315 GGAGCCAGGCACGGAGGGGAAGG - Intronic
1062294641 9:135817938-135817960 GGCCGCCGGCACGGGGCTGGAGG - Intronic
1062462019 9:136666074-136666096 GGCGGGCGGCGCGGCGGGGAGGG + Intronic
1062501778 9:136854878-136854900 GGCAGCCAGCACGGAGAGCAGGG - Intronic
1062540727 9:137040638-137040660 GGCCGCGGGCAGGGCAGGGAGGG - Intronic
1188212743 X:27443845-27443867 GGCCGCCTGGCAGGAGGGGATGG + Intergenic
1194268059 X:91779227-91779249 GGCCGCCTGCTGGGAAGGGATGG - Intergenic
1195252778 X:103064257-103064279 GGCCGCCGGCCCGTGGGGGTTGG - Intergenic
1195370246 X:104166417-104166439 CGGCGCCCGCAAGGAGGGGAAGG - Intergenic
1195750138 X:108156305-108156327 GGGAGCCGGCAAGGAGGAGATGG + Exonic
1200585262 Y:5000148-5000170 GGCCGCCTGCTGGGAAGGGATGG - Intergenic
1200766347 Y:7083807-7083829 GGCTGCTGGGATGGAGGGGAGGG - Intronic
1201424612 Y:13834336-13834358 GGGAGCCGGCATGGAGGGGAAGG - Intergenic