ID: 1053403665

View in Genome Browser
Species Human (GRCh38)
Location 9:37851388-37851410
Sequence CCGTGTTGGTCTCTAACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053403661_1053403665 26 Left 1053403661 9:37851339-37851361 CCTGGCTACTTTTGCATTTTTTC 0: 1
1: 1
2: 109
3: 2427
4: 24525
Right 1053403665 9:37851388-37851410 CCGTGTTGGTCTCTAACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053403665 Original CRISPR CCGTGTTGGTCTCTAACTTC TGG Intronic
No off target data available for this crispr