ID: 1053405424 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:37871187-37871209 |
| Sequence | TATTGGGGAAGGTGGGGGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053405415_1053405424 | -9 | Left | 1053405415 | 9:37871173-37871195 | CCTGTAGTTCCAGCTATTGGGGA | 0: 11 1: 496 2: 12749 3: 135041 4: 282350 |
||
| Right | 1053405424 | 9:37871187-37871209 | TATTGGGGAAGGTGGGGGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053405424 | Original CRISPR | TATTGGGGAAGGTGGGGGGA GGG | Intronic | ||
| No off target data available for this crispr | |||||