ID: 1053405424

View in Genome Browser
Species Human (GRCh38)
Location 9:37871187-37871209
Sequence TATTGGGGAAGGTGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053405415_1053405424 -9 Left 1053405415 9:37871173-37871195 CCTGTAGTTCCAGCTATTGGGGA 0: 11
1: 496
2: 12749
3: 135041
4: 282350
Right 1053405424 9:37871187-37871209 TATTGGGGAAGGTGGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053405424 Original CRISPR TATTGGGGAAGGTGGGGGGA GGG Intronic
No off target data available for this crispr