ID: 1053408869

View in Genome Browser
Species Human (GRCh38)
Location 9:37902889-37902911
Sequence AGGGTGACTCCAATTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053408863_1053408869 10 Left 1053408863 9:37902856-37902878 CCTAGCACAAAGGTCTCTGCAAA 0: 1
1: 0
2: 0
3: 26
4: 249
Right 1053408869 9:37902889-37902911 AGGGTGACTCCAATTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053408869 Original CRISPR AGGGTGACTCCAATTCTCAA AGG Intronic
No off target data available for this crispr