ID: 1053411967

View in Genome Browser
Species Human (GRCh38)
Location 9:37921708-37921730
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053411962_1053411967 26 Left 1053411962 9:37921659-37921681 CCTCAGTGAAGGGTCATTTCATC 0: 1
1: 0
2: 2
3: 8
4: 191
Right 1053411967 9:37921708-37921730 AGCAGGCGGCGCACTCGCTTAGG No data
1053411964_1053411967 -6 Left 1053411964 9:37921691-37921713 CCTAGACACGTCTGAGAAGCAGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1053411967 9:37921708-37921730 AGCAGGCGGCGCACTCGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr