ID: 1053412533

View in Genome Browser
Species Human (GRCh38)
Location 9:37925055-37925077
Sequence ATGTGTGCCCAGAGGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 321}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053412533_1053412539 0 Left 1053412533 9:37925055-37925077 CCCTCTGGCCTCTGGGCACACAT 0: 1
1: 0
2: 2
3: 35
4: 321
Right 1053412539 9:37925078-37925100 ACATGCCTGGCACACAGCTGGGG No data
1053412533_1053412537 -2 Left 1053412533 9:37925055-37925077 CCCTCTGGCCTCTGGGCACACAT 0: 1
1: 0
2: 2
3: 35
4: 321
Right 1053412537 9:37925076-37925098 ATACATGCCTGGCACACAGCTGG No data
1053412533_1053412538 -1 Left 1053412533 9:37925055-37925077 CCCTCTGGCCTCTGGGCACACAT 0: 1
1: 0
2: 2
3: 35
4: 321
Right 1053412538 9:37925077-37925099 TACATGCCTGGCACACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053412533 Original CRISPR ATGTGTGCCCAGAGGCCAGA GGG (reversed) Intronic
900525795 1:3127957-3127979 ACGTGTTCCCAGATGCCAGAAGG - Intronic
901400394 1:9011571-9011593 ATGTGAGCCCAGATTCCAGATGG - Intronic
901403613 1:9031677-9031699 ATCTGTGCCCAAATTCCAGAGGG + Intergenic
903353203 1:22730592-22730614 ACGTTTGAGCAGAGGCCAGAAGG + Intronic
903740667 1:25556644-25556666 CTGTGTGCCAACTGGCCAGAAGG - Intronic
903888396 1:26554500-26554522 CCCCGTGCCCAGAGGCCAGAAGG - Intronic
904045804 1:27607490-27607512 AGGAGAGGCCAGAGGCCAGAGGG + Intergenic
904210420 1:28883554-28883576 TTGTATGCCCAGAGCCCAGAGGG - Intergenic
904460987 1:30679717-30679739 ATTGGTGCCCAAAGTCCAGAGGG - Intergenic
904678380 1:32212373-32212395 CTGGGTGCCTAGAGGCCAGAGGG + Intronic
905706754 1:40066127-40066149 ATGTGAGCCCATAGGAAAGAAGG + Intronic
906157792 1:43624106-43624128 CTGTGTGTCCAGGGGCCAGATGG - Intergenic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
909197721 1:72648640-72648662 ATCAGTGCCCAAAGTCCAGAGGG - Intergenic
910549525 1:88460120-88460142 ATGTGTGCACAGAGCACTGAAGG - Intergenic
912631057 1:111247203-111247225 ATGTGTCCAAAGAGACCAGATGG - Intergenic
912898528 1:113621204-113621226 TGGTGTGCCGAAAGGCCAGAAGG + Intronic
913253208 1:116929778-116929800 ATGTGTCCCCAGTGCCTAGAAGG + Intronic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917510332 1:175664187-175664209 GTTTTTGCCCAGAGGCCAGCTGG - Intronic
917682049 1:177377327-177377349 CTCTGTGCTCAGAAGCCAGAGGG - Intergenic
918474192 1:184905550-184905572 ATGTATGCACAGGGGCAAGAAGG - Intronic
918983768 1:191596549-191596571 ATTGGTGCCCAAAGTCCAGAGGG + Intergenic
919927961 1:202202265-202202287 ATGTGTGCCCTGAGGGAAAAAGG - Intronic
920128264 1:203711095-203711117 CTGTGCGCCCAGAGGTGAGAGGG + Exonic
920992093 1:210949231-210949253 ATGTGTTTGCAGAGGACAGAAGG - Intronic
921539877 1:216399897-216399919 AGGTGTGCACAGAGGCCAGGTGG - Intronic
921766990 1:218983686-218983708 ATCAGTGCCCAAAGTCCAGAGGG + Intergenic
922740969 1:228014047-228014069 ATTTGTGCCCTGAGTCCAGCTGG - Intronic
923221235 1:231896032-231896054 ATGTGATTCCAGAGGCCAAAAGG + Intronic
924708445 1:246516508-246516530 ATGTGGGGCCAGAACCCAGAAGG - Intergenic
1063754668 10:8994210-8994232 ATGTGTGACCACAGGCTCGAAGG + Intergenic
1064283509 10:13971824-13971846 ATGTGGGGCCAGGGACCAGAGGG - Intronic
1064766726 10:18682888-18682910 ATGTGTTGACAGAAGCCAGATGG - Intergenic
1065773033 10:29095269-29095291 CTGAGAGCCCAGAGGCCAGTAGG + Intergenic
1067053326 10:43037616-43037638 GGGGGTTCCCAGAGGCCAGAGGG + Intergenic
1067544477 10:47183262-47183284 ATGTGTGCCCACAGGGCACCTGG - Intergenic
1069080830 10:64086589-64086611 ATGTGTGCCTTAAGGCCAGTTGG + Intergenic
1069561834 10:69436077-69436099 GTTTGTGCCCAGAGTCCGGAAGG + Intergenic
1069573608 10:69509067-69509089 TTTTGTGCCCAGAGGGGAGACGG + Intergenic
1070458800 10:76644269-76644291 ATGAATGCTCAGAGCCCAGACGG + Intergenic
1070781202 10:79138329-79138351 GTGGGTCCACAGAGGCCAGAAGG - Intronic
1071052895 10:81473230-81473252 ATCAGTGCCCAAAGTCCAGAAGG - Intergenic
1073845024 10:107544931-107544953 ATCGGTGCCCAAAGTCCAGAGGG - Intergenic
1075427462 10:122352957-122352979 AAGGGTGCCCTGAAGCCAGATGG - Intergenic
1076217390 10:128707112-128707134 ATCTGTGCTCAGCAGCCAGAAGG + Intergenic
1076468513 10:130702513-130702535 ATGTGTGCACAGCTGGCAGAGGG + Intergenic
1076521668 10:131085111-131085133 CTGTGTCCCCACAGGGCAGAGGG - Intergenic
1076783475 10:132737228-132737250 GTGTGTGTCCAGAGGGCAGGTGG + Intronic
1076961843 10:133769337-133769359 ATGTGTGCTCAGAAGCCACATGG - Intergenic
1077152254 11:1077609-1077631 GGGTCTGCCCAGAGGCCTGACGG - Intergenic
1077912673 11:6586925-6586947 ATTGGTGCCCAAAGCCCAGAGGG - Intronic
1077992757 11:7426497-7426519 TTGTGTGCCCAAATGCCTGAAGG - Intronic
1079504020 11:21133551-21133573 ATCAGTGCCCAAAGTCCAGAAGG + Intronic
1080115554 11:28617962-28617984 ATGTTTGAGCAGAGGCCTGAAGG + Intergenic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083446374 11:62710298-62710320 AAGGGTGCACAGAGGCGAGATGG + Intronic
1083961133 11:66015670-66015692 ATCTGTGCCCAAATCCCAGATGG + Intergenic
1084417717 11:69043057-69043079 AACTGAGCCCAGAGGCAAGAAGG - Intergenic
1084451717 11:69242931-69242953 ATGTGTGCCCACATGTGAGAAGG + Intergenic
1085511547 11:77090776-77090798 ATCTGTTCCCTGAGGCCAGGAGG - Intronic
1087453470 11:98353615-98353637 ATCAGTGCCCAAAGTCCAGAGGG + Intergenic
1087455186 11:98376309-98376331 ATTTGTGCCCAAAGGCCTTAAGG + Intergenic
1088135610 11:106552492-106552514 ACTAGTGCCCAGAGTCCAGAGGG - Intergenic
1088620608 11:111678792-111678814 ATGTGTGGGCAGAAGCCAGTAGG + Intronic
1089637663 11:119826510-119826532 CTGGGTGCCCAGAGGCAACATGG + Intergenic
1090893114 11:130945107-130945129 ATGGGAGCCCAGAGGAGAGAGGG - Intergenic
1091402836 12:191046-191068 GGGTGTGGCCAGAGGCCAGGCGG - Exonic
1092069744 12:5623027-5623049 AAGTGTTTCCAGAGGCCAGGTGG + Intronic
1093070464 12:14702799-14702821 ATGTGTTCGCACAGGCCAAAGGG - Intergenic
1094414803 12:30205151-30205173 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1094414814 12:30205269-30205291 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1096860962 12:54527780-54527802 AAGTTTGCCCAGAGGTCAGGAGG + Intronic
1098316244 12:69196247-69196269 ATGTGCTACCACAGGCCAGAAGG - Intergenic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1100881192 12:99018286-99018308 ATGTGTCCCCACATGACAGAAGG - Intronic
1101829075 12:108243078-108243100 AAGTGTCTCCAGGGGCCAGATGG - Intronic
1103201524 12:119091789-119091811 ATGTGTGCTCAGAGGATACAAGG - Intronic
1104127865 12:125864594-125864616 GTGGGTTCCCAGAAGCCAGATGG - Intergenic
1104391801 12:128397230-128397252 ACCTGTGCCCAGGGGCCATAGGG + Intronic
1104495890 12:129238173-129238195 ATGGGTGCACACAGGCAAGACGG + Intronic
1105836315 13:24215235-24215257 ATGTGTGCCAAGAGGCAGGGAGG + Intronic
1106999610 13:35527525-35527547 CTGGGTGCCCAAAGTCCAGACGG + Intronic
1107057959 13:36127130-36127152 TTGTGTGCCCCATGGCCAGATGG + Intronic
1108525365 13:51281319-51281341 TGGTGTGCTCAGTGGCCAGAGGG - Exonic
1109762258 13:66845280-66845302 ATCGGTGCCCAAAGTCCAGAGGG + Intronic
1110954186 13:81533297-81533319 AGGTATGCTCAGAGGACAGAAGG + Intergenic
1112146489 13:96705817-96705839 GCCTGTGCCCAGAGGCCAGTGGG - Intronic
1117099362 14:52331007-52331029 ATGTGTGTAAAGAGGTCAGAGGG - Intergenic
1117566802 14:57001722-57001744 ATGTGTGCCCAGGGACCCCATGG - Intergenic
1118833585 14:69458704-69458726 ATGTATTCCTAGAGTCCAGAGGG + Exonic
1119894714 14:78210259-78210281 ATGTGTGCTCACATGGCAGAAGG + Intergenic
1119977659 14:79043350-79043372 GCGTGAGCCCAGAGTCCAGAAGG + Intronic
1120978293 14:90268658-90268680 CTGTGTCCCTAGAGTCCAGATGG - Exonic
1121051172 14:90819865-90819887 AAATGAGCCCAGAGGCCACAGGG - Intergenic
1121305537 14:92904224-92904246 AGGTGTGGGAAGAGGCCAGAGGG + Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122224061 14:100262885-100262907 ATGTGTACCAAGAAGCCATAAGG - Intronic
1122386128 14:101349370-101349392 ATCAGTGCCCAAAGTCCAGAAGG + Intergenic
1124264279 15:28219614-28219636 CTGTGTGCCCCGAGCCCAGACGG + Intronic
1125733684 15:41909005-41909027 CTGTCAGCCCAGAAGCCAGATGG + Intronic
1128458069 15:67844118-67844140 CTGTGTGCCCACAGCTCAGAGGG + Intergenic
1130183105 15:81651555-81651577 ATCAGTGCCCAAAGTCCAGAGGG - Intergenic
1131605745 15:93900939-93900961 ATCAGTGCCCAAAGTCCAGAGGG + Intergenic
1132065020 15:98723915-98723937 TAGTGTGCCCAGAAGCCAGAAGG + Intronic
1132293014 15:100716190-100716212 ATGTGATCCTAGAGTCCAGAAGG - Intergenic
1132464220 16:70342-70364 ACGTCTGGCCAGAGGACAGATGG + Intronic
1132544311 16:526316-526338 ATGTGTCCCCGGGGGCCAGTGGG - Intergenic
1132756668 16:1488520-1488542 AGGTGGGGCCAGAGGCTAGAAGG - Intronic
1132937470 16:2488382-2488404 AACTGTGCCCTGTGGCCAGAGGG + Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1134126027 16:11616653-11616675 ATTTGTGTTCAAAGGCCAGAGGG - Intronic
1134263964 16:12676714-12676736 ATGTCTGACCTGAGGCCTGAGGG + Intronic
1134528804 16:14965971-14965993 CTGTGTGCCCAGAAGGCAAATGG - Intergenic
1135933913 16:26762814-26762836 ACATGAGCCCAGAGGACAGAGGG + Intergenic
1136220733 16:28826423-28826445 CTGTGTGCATAGAGGACAGAGGG + Intronic
1136227564 16:28869244-28869266 ATGAGGTCCCAGGGGCCAGAGGG - Exonic
1136228590 16:28874273-28874295 CTCAGTGCCCACAGGCCAGAGGG + Intergenic
1136565176 16:31065470-31065492 AGGTGTGCCCAGAGGCTAGGGGG + Intronic
1137523255 16:49211621-49211643 ATGTGTGACAAGGGCCCAGATGG - Intergenic
1139367500 16:66442371-66442393 ATCTGTTCCCAAAGGCCAGAGGG - Intronic
1139671068 16:68492818-68492840 GTGTTTGGCCACAGGCCAGAGGG + Intergenic
1139867560 16:70075006-70075028 CTGTGTGCCCAGAAGGCAAATGG + Intergenic
1140825931 16:78706707-78706729 ATGTGTACCCACAGGTCAAAAGG - Intronic
1140990899 16:80210458-80210480 AAGTGAGCCCAGTGGCCATATGG + Intergenic
1141425206 16:83940379-83940401 CTGTGTCCCCAGAGCCCAGCAGG - Intronic
1141625045 16:85256753-85256775 AAGTGTGTCCTGAGGCCAGAGGG - Intergenic
1141827251 16:86489220-86489242 TTGTGTGCTCAGAGTCCACAAGG - Intergenic
1142441788 16:90103188-90103210 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
1142483877 17:234584-234606 GTGTGGTCCCAGAGGACAGACGG + Intronic
1148359081 17:46996891-46996913 ATGTTAGGCCAGAGGTCAGAGGG - Intronic
1149431844 17:56600463-56600485 AAGTGTTCCAAGAGGCCTGAAGG + Intergenic
1149963587 17:61139457-61139479 ATGTGTGCCCAGAATGCACAGGG - Intronic
1150220269 17:63492074-63492096 ATGTGAGCCAAGAGGCCACTGGG - Intronic
1150299775 17:64038428-64038450 GTGTGTGTCCAGAGGCCTCAGGG + Intergenic
1150787543 17:68175234-68175256 ATGTTAGGCCAGAGGTCAGAGGG + Intergenic
1150836725 17:68570713-68570735 ATGTGTGGCCAGATGCCAAAGGG - Intronic
1151700580 17:75740613-75740635 ATCTGTTTCCAGAGGGCAGAAGG + Intronic
1152597868 17:81246626-81246648 AGCGGTGCCCAGAGGCCAGGAGG - Exonic
1152795564 17:82304509-82304531 CTTGGTGCTCAGAGGCCAGAGGG - Intergenic
1152964440 18:101505-101527 ACGTGTGCTCAGAAGCCACATGG + Intergenic
1153450251 18:5219189-5219211 CTGTGTGCACAGAAGTCAGAAGG - Intergenic
1155357059 18:24963081-24963103 TTGTGTGCCCAGAGCCTGGAAGG + Intergenic
1156393127 18:36671820-36671842 ATGTGTTCCCAAAGGCAACAAGG + Intronic
1159443215 18:68508199-68508221 TTGTGTTCACAGAGACCAGAGGG + Intergenic
1159938349 18:74386452-74386474 ATGTGAGCAGAGAGGCCAGACGG + Intergenic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1160728568 19:629988-630010 ATCTTTGCCCAGCGGCCACAGGG + Exonic
1161431321 19:4233848-4233870 ATGTATGCACAGAGACCCGAAGG - Intronic
1162013961 19:7833731-7833753 ATGTGTGCCAAGTGTACAGATGG - Intronic
1162795828 19:13087168-13087190 CTGTGTGTCCTGAAGCCAGAAGG + Intronic
1163289976 19:16372896-16372918 TTGGCTGCCCAGAGGACAGAAGG + Intronic
1163662949 19:18589374-18589396 AAGTGTCCCCAGACACCAGAGGG - Intronic
1164929990 19:32168078-32168100 ATGTTTTCGGAGAGGCCAGATGG - Intergenic
1165311832 19:35033224-35033246 ATGATAGCCTAGAGGCCAGATGG + Intronic
1165766856 19:38356938-38356960 ATCTGTGCCCAGCAGACAGAGGG + Intronic
1166320630 19:42016489-42016511 CTGTGTCCTCAGGGGCCAGAGGG - Intronic
1167673623 19:50870988-50871010 CTGTGTGGTCAGAGCCCAGAGGG + Intronic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
925367871 2:3323515-3323537 ACCTGTGCCCCGAGGCCACAAGG - Intronic
925409151 2:3628833-3628855 ATGCGTGTCCAGAGGACAGATGG + Intronic
925910086 2:8568121-8568143 CAGTGAGCCCAGAGGCCAGGAGG - Intergenic
926936798 2:18093961-18093983 ATGAGTGACCAGGGGCCAGGAGG - Intronic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
927672893 2:25083765-25083787 ATTTGGGCTCAGAGGTCAGATGG - Intronic
928433398 2:31238698-31238720 AGGAGTGACCAGGGGCCAGATGG - Intronic
928624620 2:33127174-33127196 ATGTGTGTTCAGAGCCCAGGAGG + Intronic
929429417 2:41874521-41874543 ATGTGATCCCAGTGGCTAGATGG - Intergenic
929851596 2:45596217-45596239 ATAGGTGCCCAGCTGCCAGAAGG - Intronic
931224313 2:60316433-60316455 ATGTCTGCCCAAAGGACAGTTGG - Intergenic
932347900 2:71007513-71007535 AGGCCTGCCCAGAGGCCTGAGGG - Intergenic
934555300 2:95284049-95284071 GTCTCTGCCCAGAAGCCAGATGG + Intronic
934715251 2:96539283-96539305 AAGTGGGCCAAGAGGACAGATGG - Intronic
935689837 2:105721033-105721055 CTGTGTGCTCACAGGGCAGAAGG + Intergenic
935796606 2:106647846-106647868 CTGTGAGGCCACAGGCCAGAGGG + Intergenic
936350092 2:111706086-111706108 ATGTGTGCCCTGCCCCCAGATGG + Intergenic
937252919 2:120535383-120535405 AGGGGGGCCCAAAGGCCAGATGG + Intergenic
937336512 2:121065655-121065677 AGGTGTGCCCAGCAGCCAGGTGG + Intergenic
937426374 2:121802606-121802628 AAGTGAACACAGAGGCCAGAAGG + Intergenic
937545948 2:123021152-123021174 ATGGATGCCCTGAGGTCAGAGGG - Intergenic
938065682 2:128280855-128280877 GTGTGTGTCCTGAGGCAAGAGGG - Intronic
939335631 2:140824487-140824509 ATGAGAGCCCAGTGGCCACAGGG + Intronic
939876984 2:147588601-147588623 ATGTGTCCCCAGAGGATTGAAGG - Intergenic
943345704 2:186734793-186734815 ATGAGTGCCCAAAGTCCGGAAGG + Intronic
948232164 2:236356470-236356492 ATGCTTCCCCAGAGGCCAGCTGG + Intronic
948232280 2:236358850-236358872 ATGCTTCCCCAGAGGCCAGCTGG - Intronic
948712945 2:239836530-239836552 ATTGGTGCCCAAAGTCCAGAGGG - Intergenic
1168861288 20:1047816-1047838 ATCTCTGCACAGTGGCCAGAGGG - Intergenic
1169321536 20:4636981-4637003 ATGTGTCCCATGAAGCCAGAAGG + Intergenic
1169331398 20:4719302-4719324 CTGTGTGCCCACATGGCAGAAGG + Intergenic
1170572912 20:17642442-17642464 AGGTGTGCCCTGAGGCCAGTGGG - Intronic
1171324227 20:24276653-24276675 AGGTGTGCTTAGAGGCAAGAGGG + Intergenic
1172758161 20:37302004-37302026 AGGTGTGGGCAGGGGCCAGAGGG + Intronic
1175001369 20:55633438-55633460 ATTGGTGCCCAAAGTCCAGATGG + Intergenic
1175641404 20:60633578-60633600 GTGTGTGCCCAGAGGCCAGCAGG + Intergenic
1175786124 20:61712694-61712716 ATGAGTGCCCAGAAGGCAGCAGG + Intronic
1176408349 21:6434086-6434108 ATCAGTGCCCAAAGTCCAGAGGG - Intergenic
1178244331 21:30936484-30936506 ATTGGTGCCCAAAGTCCAGAGGG - Intergenic
1179008641 21:37535848-37535870 AGGTTTGCGCAGAGGGCAGATGG + Intergenic
1179683842 21:43042412-43042434 ATCAGTGCCCAAAGTCCAGAGGG - Intergenic
1179815131 21:43900736-43900758 CTGTGTGCTCAGTGGCCAGAGGG + Intronic
1182443287 22:30376426-30376448 CTGTCTGCCCAGAGGCCTGAAGG - Exonic
1184180168 22:42816385-42816407 ATATGGGCCCAGGGGCCAGATGG - Intronic
1184224389 22:43120823-43120845 GCCTGGGCCCAGAGGCCAGATGG + Intronic
1184235414 22:43180563-43180585 CTGTGAGCTCAGAGGCCAGCTGG + Intronic
1184660561 22:45963730-45963752 CTGTGAGCCCAGAGCCCAGCTGG - Intronic
1184856133 22:47147788-47147810 AGCTGTGCCCAGTGGCCAGGAGG + Intronic
1185035648 22:48475268-48475290 ATGTGTGATCAGAGCCCACATGG - Intergenic
1185211263 22:49571809-49571831 ATGAGTGCCCAGAGGTGAGTGGG + Intronic
1185234556 22:49704553-49704575 CTGGCTGCCCAGAGGCCACAGGG - Intergenic
949818179 3:8084835-8084857 ATTTGTGCCCAGAGGACCTATGG + Intergenic
950367328 3:12496860-12496882 ATCTGTGCCCACCGGGCAGAAGG - Intronic
950459973 3:13115386-13115408 ATGGGGGCCCAGACCCCAGAGGG - Intergenic
950810988 3:15649556-15649578 ATGTGAGCTCAGAGGTCAGGCGG - Intergenic
951136286 3:19107528-19107550 ATTGGTGCCCAAAGTCCAGAGGG + Intergenic
952408486 3:33026356-33026378 ATCGGTGCCCAAAGTCCAGAGGG - Intronic
952793289 3:37217398-37217420 ATCAGTGCCCAAAGTCCAGAGGG - Intergenic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
952976060 3:38697567-38697589 ATGTGTGCCCAGAGCTGAGGAGG - Exonic
953663100 3:44905379-44905401 AAGTGTGCCCAGGGACCAGCCGG + Intronic
954195650 3:48995335-48995357 ATGTGTGAGCAGAGGCCTGCTGG - Intronic
954497982 3:50983154-50983176 CTGTGTACCCAAAGTCCAGAGGG - Intronic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
955879310 3:63526874-63526896 CTGTGTGCTCAGAGCTCAGATGG + Intronic
957347386 3:78979682-78979704 ATCTGTCCCCAGAGTGCAGAGGG + Intronic
959056722 3:101574437-101574459 ATGTAGGCCCGGAGCCCAGAGGG - Intronic
960994817 3:123333695-123333717 AGGTGTGCTCAGAGGTCAAACGG - Intronic
961167925 3:124776347-124776369 GTGTGCTCCCTGAGGCCAGAGGG - Intronic
961175810 3:124834310-124834332 TTGTGTGCGCAGTGGTCAGAGGG + Intronic
961262498 3:125613683-125613705 GAGTGTGCCAAGAGCCCAGAGGG - Intergenic
961313096 3:126016298-126016320 ATGTGTGGCCAGTGACCAGGAGG + Intronic
962920942 3:139949940-139949962 ATGTGTGTGTAGAGGCAAGAAGG + Intronic
963121085 3:141777700-141777722 ATGTGTTCCCAGAGGCCCTAAGG - Intergenic
965553303 3:169992693-169992715 ATGTGTGTACAGAGGCCTGAAGG - Exonic
965839089 3:172882684-172882706 ATGAATGCTCAGAGGACAGAGGG - Intergenic
968362053 3:198154155-198154177 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
968426463 4:526639-526661 GTGGATGCCCAGAGGCCAGGCGG - Intronic
968950261 4:3687841-3687863 GCGTGAGCCGAGAGGCCAGAAGG + Intergenic
970040298 4:11789263-11789285 ATGTGTTTCTAGAAGCCAGATGG + Intergenic
970307661 4:14750023-14750045 ATCTGTGCCCAGAGACAAAATGG - Intergenic
971927577 4:33033724-33033746 ATGATTGCTCAGAGGCAAGAGGG + Intergenic
972936965 4:44147999-44148021 AAGTCTGTCCTGAGGCCAGAGGG + Intergenic
974377077 4:61092668-61092690 AGGTGGGCTCAGAAGCCAGAAGG + Intergenic
975040915 4:69743679-69743701 CTGGGTGCCCAAAGTCCAGAGGG + Intronic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
976518103 4:85995015-85995037 ATGGGAGCCTACAGGCCAGAAGG + Exonic
976782280 4:88774153-88774175 ATGCTTGCACAGAGGCCTGAAGG - Intronic
979808984 4:125012026-125012048 ATGTACACCCAGAAGCCAGAGGG - Intergenic
980281738 4:130731967-130731989 ATGTGAGGCCAGAGGGCAAACGG + Intergenic
980671098 4:136008459-136008481 GTTGGTGCCCAGAGTCCAGAGGG - Intergenic
983069758 4:163254297-163254319 ATTGGTGCCCAAAGTCCAGAGGG + Intergenic
983125921 4:163950282-163950304 ATCAGTGCCCAAAGTCCAGAGGG + Intronic
983252271 4:165358576-165358598 ATGTGTACCATGAGACCAGAAGG + Intergenic
985198897 4:187463245-187463267 ATGTGTGCCCACATGGCACAAGG - Intergenic
985373163 4:189308061-189308083 ATGAGGGCCCACAGGCCACACGG + Intergenic
985373218 4:189308313-189308335 ATGAGGGCCCACAGGCCACACGG + Intergenic
985373492 4:189309531-189309553 ATGTGGGCCCACAGGCCACGCGG + Intergenic
985465074 4:190186818-190186840 ATGTGTGCTCAGAAGCCACATGG - Intergenic
985552174 5:539353-539375 ATCGGGGACCAGAGGCCAGAGGG + Intergenic
985803438 5:2021346-2021368 ATGCGGGCACAGAGGCCAGGAGG - Intergenic
985880222 5:2633653-2633675 ATCTGTGTTCAGAGGGCAGAGGG + Intergenic
985923579 5:2998534-2998556 ATGTGTGCCCTGAGTTCAGCGGG - Intergenic
986179846 5:5383433-5383455 AAGGATGCCCAGAGGCCAAAGGG - Intergenic
986569245 5:9148395-9148417 ATGAGTGCACAGAGGCCACAGGG + Intronic
986645767 5:9914535-9914557 ATGTGTGTACAGAGGCTAAATGG + Intergenic
989573636 5:42968841-42968863 ATGTTTGCCTAGAAGCCAGTAGG - Intergenic
989580424 5:43027783-43027805 ATTTTTGCCTAGAGGCCAGCAGG - Intergenic
990611156 5:57458094-57458116 ATGAGCGCCCCCAGGCCAGATGG - Intergenic
992169703 5:74089560-74089582 AAGTGTCTCCAGAGGCCAGCAGG + Intergenic
992745026 5:79811084-79811106 ATGTCTGGACAAAGGCCAGATGG + Intergenic
992885140 5:81151212-81151234 ATGCCTCTCCAGAGGCCAGAGGG - Intronic
995386556 5:111595816-111595838 ATGTGTGCCCAAAGTCCAGATGG - Intergenic
996254255 5:121378845-121378867 ATGAGTGCCCAGAGTCCACCTGG + Intergenic
996568355 5:124905886-124905908 ATGAGTGCCCACATGTCAGACGG - Intergenic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
997654013 5:135542290-135542312 TTTTGTGCCCAAAGGCCAGTGGG + Intergenic
998388540 5:141772459-141772481 ATGTGTGGGCCGAGGGCAGAAGG + Intergenic
999089323 5:148921524-148921546 ATGTGTGCCCTGGAGCCAGAGGG + Intergenic
999318387 5:150598834-150598856 AGGGGTCCCCAGAGGCCTGAAGG + Intergenic
1001038444 5:168314842-168314864 AGGTGTGGCCAGATTCCAGAGGG + Intronic
1002054342 5:176590147-176590169 GTGAGTGCCCAGAGGCCTGGGGG + Intronic
1002192299 5:177484610-177484632 ATGTGGTCCCACGGGCCAGATGG - Intronic
1002879417 6:1238154-1238176 CTGTGGGCCCAGGGGCCAGGTGG + Intergenic
1003565328 6:7217239-7217261 TTCTGTCTCCAGAGGCCAGAAGG - Intronic
1003784313 6:9467138-9467160 AGGTGTACCCAGAGCCCAGTAGG - Intergenic
1005845298 6:29772320-29772342 GTATGTGCCCAGAGACCAGCTGG + Intergenic
1006510713 6:34519654-34519676 ATGAGTGCCCAGTGCACAGAAGG - Intronic
1007074767 6:39059451-39059473 AGGTGTGCCCAGACAGCAGAGGG - Intronic
1007642795 6:43356082-43356104 ATGGGTGCCCAGAGTAGAGAGGG + Exonic
1008206989 6:48672492-48672514 ATATGTGCTCAGAGACCAAAAGG + Intergenic
1009785400 6:68331503-68331525 GTGTGTGCACAGATACCAGAAGG + Intergenic
1012491142 6:99783664-99783686 CTGTGTGGCCTGAGGCCTGAAGG + Intergenic
1017012121 6:150069984-150070006 ATCTGTGGGCAGAAGCCAGAGGG + Intergenic
1018455905 6:163951975-163951997 ATGTGTGCTAAGAGGCAAAATGG - Intergenic
1018948268 6:168361989-168362011 ATGGGTGTCCAAACGCCAGAGGG + Intergenic
1019253627 7:34552-34574 CGGTCTGCCCAGAGGCCAGCAGG - Intergenic
1019309664 7:353860-353882 ATGTGGGCGCAGCGCCCAGAGGG + Intergenic
1019341029 7:509041-509063 AAGTGTGCCCAGAGACCTGCAGG - Intronic
1019470533 7:1218048-1218070 CTGAGTGCCCAGGGGTCAGAGGG - Intergenic
1019558744 7:1645496-1645518 CTGTGGGCCCGGAGGCCAGCGGG - Intergenic
1021566701 7:22023663-22023685 ATGGGTGCCCAGTGGGCACATGG - Intergenic
1021566945 7:22025591-22025613 ATGAGTGCCCAGTGGGCACACGG - Intergenic
1022800901 7:33776358-33776380 ATGTATCCCCAGGAGCCAGAAGG - Intergenic
1024217387 7:47258982-47259004 ATGTTTGGCCATATGCCAGAAGG + Intergenic
1024629278 7:51234279-51234301 AGAAGTGCCCAGAGGCCACATGG - Intronic
1025501230 7:61301619-61301641 CTATGTCCCCAGAGGCCACAAGG + Intergenic
1025516090 7:61647842-61647864 CTATGTCCCCAGAGGCCACAAGG + Intergenic
1025540427 7:62076668-62076690 CTATGTCCCCAGAGGCCACAAGG + Intergenic
1025846178 7:65200288-65200310 AGGAGTGCCTAGAGCCCAGAAGG + Intergenic
1026765540 7:73157230-73157252 TTGTGTTCCCAGAGGCCAGCAGG - Intergenic
1027042013 7:74966923-74966945 TTGTGTTCCCAGAGGCCAGCAGG - Intronic
1027081628 7:75235431-75235453 TTGTGTTCCCAGAGGCCAGCAGG + Intergenic
1027911763 7:84260685-84260707 ATTTGTGCCCAAAGTCCAGAGGG - Intronic
1028527461 7:91801556-91801578 ATCAGTGCCCAAAGTCCAGAGGG + Intronic
1028639893 7:93030062-93030084 AAGTGTGCACAGTTGCCAGAAGG + Intergenic
1028876153 7:95825557-95825579 ATCAGTGCCCAGAAGCAAGAAGG + Intronic
1029390213 7:100270012-100270034 TTGTGTTCCCAGAGGCCAGCAGG + Intronic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1032543626 7:132724483-132724505 ATGTGTGAGCAGAGGTCAGCAGG - Intronic
1032841525 7:135717789-135717811 ATGTCTGTCCAGATGGCAGAGGG - Intronic
1033841985 7:145386355-145386377 ATGTGTGCCCAGTGACCAACTGG + Intergenic
1034406046 7:150903072-150903094 AGGTGGGCCCTGAGGTCAGACGG + Intergenic
1035617520 8:1013068-1013090 ATAGGTGCCCAGGGGCCGGAGGG - Intergenic
1035756110 8:2034211-2034233 AGGTGGGGCCAGAGCCCAGATGG - Intergenic
1036446966 8:8829885-8829907 AGAGGTGCCCAGAGGCCAGATGG + Intronic
1038459337 8:27703010-27703032 AGCTGGGCCCAGAGGCCAGCTGG + Intergenic
1040834418 8:51717647-51717669 GTGTGTGACCAGAGACCACAGGG + Intronic
1042004878 8:64169253-64169275 ACCAGTGCCCAGAGTCCAGAAGG - Intergenic
1043666810 8:82825379-82825401 ATCAGTGCCCAAAGTCCAGATGG - Intergenic
1043980071 8:86627752-86627774 TTGTGTGCCCTGAGGCAGGATGG + Intronic
1045799873 8:106089655-106089677 ATGTGTGCACAGTGGGCAAAAGG - Intergenic
1046370333 8:113296604-113296626 ATGTGTGACCAGATTCTAGAAGG + Intronic
1048098027 8:131315534-131315556 ATGTGTACCTGGAGGCCACAGGG - Intergenic
1048291454 8:133184719-133184741 AGGCCTGCCTAGAGGCCAGAGGG - Intergenic
1048826545 8:138432970-138432992 ATCTGTTCCCAGAGGACTGACGG + Intronic
1049435991 8:142586497-142586519 TTGGGTGCCCAGAGGACAGTGGG + Intergenic
1050937193 9:11413575-11413597 ATCAGTGCCCAAAGTCCAGACGG - Intergenic
1052515545 9:29474682-29474704 ATGAGTACCCAGTGGCCACATGG + Intergenic
1053370858 9:37560508-37560530 ATGTGTGCTCGGAGTCAAGAGGG - Intronic
1053412533 9:37925055-37925077 ATGTGTGCCCAGAGGCCAGAGGG - Intronic
1056269221 9:84930362-84930384 ATGTGGGCCCAGAGCTCAGTGGG + Intronic
1056462125 9:86818371-86818393 ATCAGTGCCCAAAGTCCAGATGG - Intergenic
1057385758 9:94604788-94604810 ATGTTTTCCCAGTGGACAGATGG - Intronic
1057827999 9:98385905-98385927 ATGTGTCCCCTGAGGCCCCATGG - Intronic
1057911402 9:99022876-99022898 CTGGGTGCCCAGAGTCCAGCAGG - Intronic
1058079526 9:100687525-100687547 AAGTGTGCCCCGGGTCCAGAGGG + Intergenic
1058093169 9:100828914-100828936 ATGTCTACTCAGAGGCCCGAAGG - Intergenic
1061399887 9:130362619-130362641 ATGTGTGGCGAGTGGACAGAGGG + Intronic
1062746741 9:138217817-138217839 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
1186510857 X:10128763-10128785 ATGGGTGCCCTGTGGTCAGAAGG + Intronic
1187096170 X:16150769-16150791 ATGTGTGGCCAGATGCTAAATGG + Intronic
1188647820 X:32592000-32592022 ATCAGTGCCCAAAGTCCAGACGG - Intronic
1189125132 X:38437760-38437782 ACTTGTGTCCAGGGGCCAGAAGG + Intronic
1189856413 X:45229240-45229262 ATTGGTGCCCAAAGTCCAGAAGG + Intergenic
1190621055 X:52287579-52287601 ATCAGTGCCCAAAGTCCAGAGGG - Intergenic
1195048799 X:101078769-101078791 ACGTGTGCTCACAGGCCAAAAGG - Exonic
1196594530 X:117528268-117528290 AGGTATGCCCAGAGGACTGAGGG - Intergenic
1199787471 X:151117833-151117855 CTGTGAGCCCACAGGCAAGAAGG - Intergenic