ID: 1053414432

View in Genome Browser
Species Human (GRCh38)
Location 9:37938141-37938163
Sequence GAGGCTGCACAGATGCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 307}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053414432_1053414435 17 Left 1053414432 9:37938141-37938163 CCTACCTGCATCTGTGCAGCCTC 0: 1
1: 0
2: 3
3: 33
4: 307
Right 1053414435 9:37938181-37938203 TTCCACTGCCATTGCAAATCTGG No data
1053414432_1053414440 26 Left 1053414432 9:37938141-37938163 CCTACCTGCATCTGTGCAGCCTC 0: 1
1: 0
2: 3
3: 33
4: 307
Right 1053414440 9:37938190-37938212 CATTGCAAATCTGGGCCTCAGGG No data
1053414432_1053414439 25 Left 1053414432 9:37938141-37938163 CCTACCTGCATCTGTGCAGCCTC 0: 1
1: 0
2: 3
3: 33
4: 307
Right 1053414439 9:37938189-37938211 CCATTGCAAATCTGGGCCTCAGG No data
1053414432_1053414436 18 Left 1053414432 9:37938141-37938163 CCTACCTGCATCTGTGCAGCCTC 0: 1
1: 0
2: 3
3: 33
4: 307
Right 1053414436 9:37938182-37938204 TCCACTGCCATTGCAAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053414432 Original CRISPR GAGGCTGCACAGATGCAGGT AGG (reversed) Intronic
900094426 1:934544-934566 GAGGCTGCTCCGTTACAGGTGGG + Intronic
900094435 1:934572-934594 GAGGCTGCTCCGTTACAGGTGGG + Intronic
900389966 1:2429510-2429532 GAGGCTGAGCAGAGGCTGGTGGG + Intronic
900409776 1:2507344-2507366 AAGGCTACAGAGATGCAGGCTGG + Intergenic
900616148 1:3566557-3566579 GACGCTGCCCAGAGACAGGTGGG - Intronic
900737420 1:4307921-4307943 GTGGCTGCAGAGATGCAGGCTGG + Intergenic
900794867 1:4701831-4701853 GATGCTGCGTAGATGCAGGGTGG + Intronic
900988531 1:6087001-6087023 GAGGATGGAAAGATGTAGGTGGG - Intronic
901567720 1:10132465-10132487 AAGAAAGCACAGATGCAGGTAGG + Exonic
901703775 1:11059240-11059262 GTGGCTGCAGAGAGGCAGGTTGG + Exonic
903579092 1:24357706-24357728 GAGGCTGCACAGATTCGCGGTGG - Exonic
904437348 1:30507435-30507457 GAGGTTGCACAGAGGAAGGAGGG - Intergenic
905106139 1:35564650-35564672 GGGGCTGCAGAGATGCAGCCTGG - Intronic
905163467 1:36058966-36058988 GGAGCTGCACAGATTCATGTGGG + Exonic
907372992 1:54014889-54014911 GAGTCTGCTGGGATGCAGGTTGG + Intronic
908780748 1:67686850-67686872 GAGGCAGTGCAGATGTAGGTAGG - Intronic
909085691 1:71167702-71167724 GAAGCTGCACAGATCCTGCTTGG + Intergenic
912000763 1:104831969-104831991 GAGGCTGCACAGAGCCAAGATGG + Intergenic
912655508 1:111482954-111482976 GAGGGTGTAGATATGCAGGTGGG + Intergenic
913045664 1:115071833-115071855 GAGGTAGCACAGCTGCAGGCTGG + Intronic
913516920 1:119612813-119612835 GAGTCTGCAAAGACCCAGGTGGG + Intergenic
913600990 1:120421025-120421047 GAAGCTGCCCAGCTGCAGGTGGG - Intergenic
914086065 1:144455608-144455630 GAAGCTTCCCAGCTGCAGGTGGG + Intronic
914191957 1:145419559-145419581 GAAGCTGCCCAGCTGCAGGTGGG + Intergenic
914362128 1:146944467-146944489 GAAGCTGCCCGGCTGCAGGTGGG - Intronic
914489498 1:148142488-148142510 GAAGCTGCCCGGCTGCAGGTGGG + Intronic
914513004 1:148351328-148351350 GAGGCTGCCCCGCTGCAGGTGGG + Intergenic
914589864 1:149097509-149097531 GAAGCTGCCCAGCTGCAGGTGGG + Intronic
915253013 1:154603827-154603849 GAGGCTGCACAGGTAGAGGTGGG + Intronic
915939919 1:160112524-160112546 GACGCTGCTCAGCTGCAGATGGG - Intergenic
917719274 1:177770639-177770661 GAGGTTGCACAGATGCTTATTGG - Intergenic
919274750 1:195399427-195399449 GAGGCTGCACAGTTGTGAGTTGG - Intergenic
922484441 1:225962458-225962480 GAGCCTGGGCAGCTGCAGGTGGG - Intergenic
922864391 1:228847211-228847233 GAGCCTGCACAGAAATAGGTAGG - Intergenic
923666514 1:236003018-236003040 CAGGAAGCAGAGATGCAGGTGGG - Intronic
924394731 1:243606831-243606853 AAGGCTGCACAGAGCCGGGTTGG - Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
1063144053 10:3280443-3280465 GAGGCTGGACGGATGCATTTAGG - Intergenic
1064284407 10:13980046-13980068 GAGGCTGCACTAATGTAAGTGGG + Intronic
1066438068 10:35412456-35412478 GAGGCTGCAGAGAAGAGGGTGGG + Intronic
1066515178 10:36151052-36151074 GAGGCAACAAAGAAGCAGGTTGG + Intergenic
1067054777 10:43044194-43044216 GCAGCTGCACAGAGGCTGGTGGG + Intergenic
1067191359 10:44070801-44070823 GATGCTGCACAGACACAGGGAGG + Intergenic
1067687149 10:48472647-48472669 GAAGCAGCACAGAGGCAGATGGG - Intronic
1069086775 10:64149689-64149711 GATGCTCTACAGATGCATGTTGG + Intergenic
1069503773 10:68978053-68978075 GAGGCTGCAGAGATCCATGATGG + Intronic
1069897288 10:71687598-71687620 GAGGCTGCAGGGAGGCAGGTGGG - Intronic
1069967777 10:72135699-72135721 GAGGCAGGACAGAAGCAGGAAGG + Intronic
1070194045 10:74140090-74140112 AAGGATGCTCAGCTGCAGGTGGG - Intronic
1070527849 10:77310603-77310625 AAGGCTGCTCAGAGGCAGCTGGG - Intronic
1070549809 10:77482268-77482290 GAGTCAGGACAGATGCACGTGGG - Intronic
1070732122 10:78837274-78837296 GAGGGTTGACTGATGCAGGTTGG - Intergenic
1072550604 10:96474393-96474415 GAGGCATCACAAATGCAGCTGGG + Intronic
1072612808 10:97030374-97030396 AAAGCTGCACAGCTGCAGGGTGG - Intronic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074532224 10:114305549-114305571 GAGGGGACACAGATGCAGGAGGG + Intronic
1075449539 10:122540175-122540197 AAGTCTGCAGAGAGGCAGGTGGG + Intergenic
1075461700 10:122620744-122620766 GAAGCTGCACAGCTCCAGATAGG - Intronic
1075987684 10:126801848-126801870 GAGGATGCAGAGATGTTGGTGGG - Intergenic
1076919739 10:133445436-133445458 GCGGCTGCGCAGGTGAAGGTGGG + Intergenic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1077514745 11:2994662-2994684 GAGTCTTCACAGATGCAATTAGG + Intergenic
1078106512 11:8361396-8361418 GGGTCTGGTCAGATGCAGGTTGG - Intergenic
1078549092 11:12268299-12268321 GGGTCTGCACAGCAGCAGGTGGG + Intergenic
1079122395 11:17695481-17695503 GGGGCTTCACAAATCCAGGTAGG + Intergenic
1079165277 11:18035090-18035112 CAGGCTGCACAGCAGCAGGTGGG - Intronic
1081807288 11:45897421-45897443 GAGGCTGCACAGATGGGGTCAGG - Intronic
1082985786 11:59170158-59170180 TAGGCTGGACATAGGCAGGTAGG + Intergenic
1082985962 11:59171874-59171896 GAGGCTGCAAAGTTGCGGCTGGG + Intronic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1084152071 11:67292297-67292319 GGGGCTGCTCAGGGGCAGGTGGG + Intronic
1084365276 11:68693521-68693543 GAGGCTGCACACCTGCATGGAGG - Intergenic
1084428373 11:69097821-69097843 GAGGCTGCTGGGATCCAGGTGGG - Intergenic
1084561455 11:69907829-69907851 GAGGCAGCAAAGAAGGAGGTGGG + Intergenic
1084627968 11:70323426-70323448 GAGGCTGGACAGAGGTAGGAAGG + Intronic
1084942429 11:72620169-72620191 CAGGCTGCACACCTGAAGGTGGG - Intronic
1085715430 11:78868759-78868781 GCTGATGCACAGATGCAAGTGGG - Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1087868802 11:103266277-103266299 GAGGCAGCACAGCTGCGGGGAGG + Intronic
1088810388 11:113387901-113387923 GAGGCTGCCCAGCCGCAGCTCGG - Exonic
1089253997 11:117184233-117184255 GAGGATGCAGATATGCTGGTGGG + Intronic
1090415410 11:126536976-126536998 GAGGCGGCTCAGAGGCAGGCAGG + Intronic
1091139387 11:133222286-133222308 GAGGTTTCAGAGATGCAGGGTGG + Intronic
1092094585 12:5831142-5831164 GAGGATGCACTGATGAAGGAAGG + Intronic
1092465232 12:8725610-8725632 GAGGCTGCAAGGGGGCAGGTAGG + Intronic
1095139631 12:38645636-38645658 GGGGCTGCACAGAGCCAGGCAGG + Intergenic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1096773671 12:53951519-53951541 GAGGCTGCTAGGATGCAGGAGGG + Intergenic
1098411411 12:70188331-70188353 GAGGCTGGACACAGGCAAGTTGG + Intergenic
1101540705 12:105662430-105662452 GAGGGTGCAGTGATGCAGCTAGG + Intergenic
1102027557 12:109722162-109722184 GAGGCAGCTCAGAGGCAGGCAGG + Intronic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1102212335 12:111136478-111136500 GAGGCTGCTCAAATGCAGCTGGG - Intronic
1103731688 12:123032087-123032109 CTGGCTGCACAGCTGCAGGAAGG + Intronic
1104477784 12:129084604-129084626 GGGGCTGCTCAGGTGCTGGTAGG + Exonic
1104896546 12:132167702-132167724 GAGGCTGCAGAGAGGGAGGGTGG - Intergenic
1106006119 13:25771692-25771714 GAGGGTGCACAGAAACATGTGGG - Intronic
1111077987 13:83263975-83263997 GAGGCTGCACAGAGTATGGTGGG - Intergenic
1113439565 13:110317525-110317547 GAGGCTGGACAGAGGCGGGAGGG + Intronic
1115406431 14:33022072-33022094 GAGGCTACAGAGATGCAGCCTGG - Intronic
1116239870 14:42326356-42326378 GAGGCTGCAAAGAAACAGGAAGG - Intergenic
1117743722 14:58845831-58845853 GAGCCTGCTCAGATTCAGGGAGG + Intergenic
1119948578 14:78720623-78720645 GAGAGTGGACAGATGCAGGATGG - Intronic
1120142995 14:80949311-80949333 GAGTTTGGAAAGATGCAGGTAGG + Intronic
1120657318 14:87207821-87207843 GATGCTGCTCAGATGCAGATTGG + Intergenic
1121122198 14:91383104-91383126 GAGGCTGCAGTGATGCAGGAAGG - Intronic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1122298000 14:100716284-100716306 GAAGCTGCCCAGAGACAGGTGGG - Intergenic
1123006028 14:105324319-105324341 CAGGGTGCTCAGGTGCAGGTGGG + Intronic
1202892378 14_KI270722v1_random:170415-170437 GGTACTCCACAGATGCAGGTCGG - Intergenic
1123583227 15:21735546-21735568 CAGGCTGCTCAGCTGCATGTAGG + Intergenic
1123619877 15:22178143-22178165 CAGGCTGCTCAGCTGCATGTAGG + Intergenic
1128229267 15:66023639-66023661 GAGTCTGCACAGACCCAAGTGGG + Intronic
1128931682 15:71709997-71710019 GAAGCTGCTCAGATCCAGGCTGG + Intronic
1129175915 15:73839614-73839636 AAGGCTGCACAGGTGGAGGTGGG + Intergenic
1129198917 15:73987018-73987040 AAAGCAGCACAGAGGCAGGTGGG + Intronic
1129672367 15:77614356-77614378 GTAGCTGCGCACATGCAGGTGGG + Exonic
1131464982 15:92647658-92647680 GATGCTACACAGAATCAGGTTGG - Intronic
1132052137 15:98615990-98616012 GAAGCTGCACAAATACAGGTTGG - Intergenic
1132212678 15:100036083-100036105 GAGGCTGCAAAGATGATGGCTGG + Intronic
1132656122 16:1042698-1042720 GGGGCTGCAGAGAAGCAGGCAGG + Intergenic
1133030031 16:3006165-3006187 GAGGCTGCACAGAAACTGGCAGG - Intergenic
1133781627 16:8943430-8943452 CGAGCTGCACAGATGCAGTTAGG + Intronic
1134087557 16:11368531-11368553 GAGGCTCCACACATGCTGGGGGG - Intronic
1134843352 16:17419275-17419297 GAGGCTGCAGAGAGCCAGGATGG + Intronic
1136366436 16:29811317-29811339 GCGGCAGCACAGATACAGGGCGG + Intronic
1137604246 16:49776536-49776558 GAGGCTGGACAGCTGCAGGTTGG - Intronic
1137949045 16:52764579-52764601 GAGGTTGCACAGAGACAGGCAGG + Intergenic
1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG + Intergenic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1139544281 16:67642356-67642378 GAGGCTGCAGCGATGCCAGTGGG - Intergenic
1140193262 16:72836169-72836191 GTGGCTACACCGATGGAGGTGGG + Intronic
1141462157 16:84184027-84184049 GAGCCAGCACAGGTGGAGGTCGG - Intronic
1141984825 16:87572868-87572890 GAGACTGCAGAGAACCAGGTGGG - Intergenic
1142022311 16:87791540-87791562 GAGGCTCCCCAGAGGCTGGTGGG - Intergenic
1142636692 17:1261936-1261958 GAGGCTGCAGAGGTTCGGGTGGG + Intergenic
1143275462 17:5706552-5706574 AAGGCAGCAAAGAAGCAGGTAGG - Intergenic
1143350154 17:6282160-6282182 AAGGCTGAATAGATGCAGGGAGG + Intergenic
1146421969 17:32695348-32695370 CAGGCCGCACAGCAGCAGGTGGG - Intronic
1148109877 17:45138265-45138287 GAGGCTGTGCAGCTGTAGGTGGG - Intronic
1148612090 17:48971409-48971431 GAGGCTGCAGAGAAGGGGGTGGG - Intergenic
1148685296 17:49497363-49497385 GACGCTGCTCAGACGCGGGTGGG + Intronic
1148876892 17:50693431-50693453 AAGACTGCACAGTTGCTGGTAGG - Exonic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1152279235 17:79375634-79375656 GTGGCTGCAGTGATGGAGGTGGG + Intronic
1152467026 17:80472274-80472296 GAGGCTGCACAGATGTCGCACGG - Intronic
1152633822 17:81422500-81422522 GAGGCTGGTCAGGTGCAGGGAGG + Intronic
1153985084 18:10344224-10344246 GAGGCTGCACAGGTTCAGGGCGG - Intergenic
1155254548 18:23983294-23983316 AAGGCTGGACAGATCCACGTAGG - Intergenic
1155593362 18:27453661-27453683 GAGGCTGCACTGCTGGTGGTAGG - Intergenic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1157562390 18:48657673-48657695 GAGGCTGCAGAGCTGCAGAGAGG + Intronic
1158367032 18:56747724-56747746 CAGCCTGTGCAGATGCAGGTGGG + Intronic
1160317319 18:77859768-77859790 GAGGCTGGAGGGAGGCAGGTAGG + Intergenic
1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG + Exonic
1161489751 19:4555439-4555461 GGGGCTGATCAGATGGAGGTTGG + Intronic
1162773543 19:12965176-12965198 GCGACTGCACTGATCCAGGTAGG + Intronic
1163638732 19:18450025-18450047 GAGGCAGCACAGGTGCAGATGGG - Intronic
1164463721 19:28470114-28470136 GAGGCAGAACAGATGGAGATGGG + Intergenic
1164850940 19:31483620-31483642 GAGGCTGCACAGGAGCAGCAGGG + Intergenic
1166294175 19:41880925-41880947 GAGGCTGCCCACATCCTGGTAGG - Exonic
1166357559 19:42236138-42236160 GAGCCTGCACAGATGATGGACGG + Intronic
1167017297 19:46849641-46849663 GAGGATGCAGAGATTCAGGACGG - Intronic
1167240031 19:48338257-48338279 GAGGCTGGAGTGATGCAGGCGGG - Intronic
925018580 2:551291-551313 GAGGCTGCAGTGAAGGAGGTGGG + Intergenic
925072628 2:983216-983238 GAAGCTGCAGAGGTGGAGGTTGG + Intronic
925800926 2:7599591-7599613 GAGACTGCAAAGATGGCGGTGGG + Intergenic
926880890 2:17542309-17542331 AATGCTGCACTGAAGCAGGTTGG + Intronic
930798465 2:55418952-55418974 GTGGCTGCAGAGATGGAGGTGGG - Intronic
932301247 2:70668384-70668406 GAGGCTGTCCAGATGCAGTGTGG - Intronic
932839355 2:75067383-75067405 GAGGCTGCATAGTTGCTGCTAGG + Intronic
934564629 2:95331431-95331453 GAGGCTTCAAGGAGGCAGGTGGG + Intronic
936042542 2:109160858-109160880 GAGGCTGCAAGGCTGCAGGTGGG + Intronic
936267198 2:111019745-111019767 GAGGCTGCAGAGATCCTGGCAGG + Intronic
938092759 2:128444159-128444181 GGGGCTGCACAGACACAGGAGGG - Intergenic
938114121 2:128591764-128591786 GTGGCTGCAGAGATGCTGGTGGG + Intergenic
938301778 2:130219793-130219815 GAGGCTGTGCAGAGGCAGTTTGG - Intergenic
945328335 2:208509817-208509839 GAAGCAGCACAGGTGCAGTTTGG - Intronic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
946372713 2:219290422-219290444 GAGGAGGCGCAGAAGCAGGTGGG + Intronic
947254683 2:228148684-228148706 AAGGCAGCAGAGAGGCAGGTAGG + Intronic
948863058 2:240762203-240762225 GAGGTGGCCCACATGCAGGTGGG - Intronic
1169036922 20:2461490-2461512 GAGGATGTACAGATGCAAATGGG + Intergenic
1169309120 20:4520115-4520137 GATGCTCCACATTTGCAGGTGGG + Intergenic
1169620020 20:7495477-7495499 GAGGGGGTACATATGCAGGTTGG - Intergenic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1171225147 20:23436424-23436446 GAGGGTGCCCAGCAGCAGGTGGG + Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1173298801 20:41782355-41782377 GGCCCTGCACAGAGGCAGGTGGG + Intergenic
1173419321 20:42886934-42886956 CAGGGTGCACAAATGCAGGGAGG + Intronic
1173851590 20:46221946-46221968 GGGGCTGCACAGACTCAGATAGG + Intronic
1174065243 20:47860023-47860045 GTGGCTGCAGAGAGGCAGGATGG - Intergenic
1176286650 21:5022341-5022363 GAGGCGGGACAGAGGCAGGTCGG - Intergenic
1177198229 21:17925154-17925176 GAGGCTGCTCATACGCAGATTGG - Intronic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179570744 21:42277496-42277518 GAGCAGGGACAGATGCAGGTGGG + Intronic
1179642593 21:42757198-42757220 GAGACAGTACAGATGTAGGTTGG - Intronic
1179870531 21:44241134-44241156 GAGGCGGGACAGAGGCAGGTCGG + Intergenic
1180051878 21:45335266-45335288 GAGGGGGCACAGATCCAGGGAGG - Intergenic
1180051923 21:45335379-45335401 GAGGGGGCACAGATCCAGGGAGG - Intergenic
1180160175 21:45995680-45995702 CAGGCTGCACAGGGGCTGGTGGG + Intronic
1180945324 22:19689279-19689301 GTGGTTGCACAGTTGCAGGTGGG + Intergenic
1181112782 22:20611678-20611700 GAGGCTGCAGCGCTGCAGGGTGG - Intergenic
1181519174 22:23435510-23435532 GAGGCTGCTCAGGTCCAAGTAGG + Intergenic
1181786868 22:25233481-25233503 GGGGCTGCACAGCAGGAGGTGGG + Intergenic
1182869346 22:33632589-33632611 GAGGCAACACAGAGGCAGGAAGG - Intronic
1183487988 22:38099773-38099795 GAGGCTGCGCAGAGGCGGGAGGG - Intronic
1183782381 22:40007197-40007219 GAGGCTGCACAGCTGCCCGCAGG - Intronic
1183833083 22:40429555-40429577 GAGGCAGCTGAGATGCAGGAGGG - Intronic
1184243291 22:43222739-43222761 GAGTCTGCAGAGAAGCCGGTGGG + Exonic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184549996 22:45199424-45199446 GAGGCTGCACAGAGCCAGGAGGG + Intronic
1184697214 22:46146727-46146749 GAGGCAGTGCAGCTGCAGGTGGG + Intergenic
1184860938 22:47173066-47173088 GAGGCTGCAAAGCTGCAGCAGGG + Intronic
1185332251 22:50257044-50257066 GAGGCTGCAGGGAGGCAGGCAGG - Intronic
949484018 3:4520078-4520100 GAGGCAGCACAGATGAATGGAGG + Intronic
950104060 3:10377268-10377290 GAGGCTCCGCAGCTGGAGGTGGG - Intronic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
954465147 3:50649897-50649919 GAGGGTGCAGAGATGCTGGAAGG + Intergenic
954717068 3:52532224-52532246 GAGGCTCCAAAGATGCAGGCAGG + Intronic
955447485 3:59029537-59029559 GAGGAAGCAAAGAAGCAGGTTGG + Intronic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
962392152 3:134981660-134981682 GTGGGTGCACAGATGCACGCAGG - Intronic
963755750 3:149233493-149233515 GTGTCTGCATAGATGCTGGTGGG + Intergenic
963872315 3:150430644-150430666 GAGGCTGCAGACTTGCAGGTTGG + Intronic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
967115549 3:186334290-186334312 GAAGCAGTACAGATGCAGGGTGG - Intronic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967713579 3:192737734-192737756 TGGGCAGCACAGATGGAGGTGGG + Intronic
968611993 4:1561529-1561551 GGGGCTGCACAGAGGCTGGGTGG + Intergenic
968759336 4:2433949-2433971 GAGGCTTCTCAGATGGATGTCGG - Intronic
968943962 4:3653991-3654013 CAGGCTTCTCAGTTGCAGGTGGG + Intergenic
969350784 4:6596849-6596871 CAGGCTGCACTGGGGCAGGTGGG - Intronic
970251998 4:14126424-14126446 GAGGCCCTACACATGCAGGTAGG + Intergenic
972305138 4:37823623-37823645 GAGGCTGCACAGACTCATCTGGG + Intergenic
972794005 4:42398400-42398422 GAGGATGCACAGACCCAGGCAGG + Intronic
975359516 4:73451558-73451580 GAGGCTGCAGGGATGCAGGATGG + Intronic
979566239 4:122157303-122157325 GATGCAGCAAAGATGTAGGTTGG + Intronic
979670977 4:123359928-123359950 CAGACTGCAGAGAGGCAGGTAGG - Intergenic
980129618 4:128806188-128806210 GAGGCTGCACTGAGCCATGTTGG + Intergenic
983649046 4:170020592-170020614 GAGGCTCCAGAGATGCAGTCAGG - Intronic
983649067 4:170020646-170020668 GAGGCTCCAGAGATGCAGTCAGG - Intronic
986626624 5:9728922-9728944 GAGGCTTCCCTGATGCAGGCAGG + Intergenic
987229383 5:15877469-15877491 GAGACTGAAGAGATGCAGTTGGG + Intronic
988318957 5:29668565-29668587 GAGGCTGCAAAGATGCCAGGTGG - Intergenic
989666523 5:43860239-43860261 GAGGTTGCACAGATGCAGAGTGG - Intergenic
991261978 5:64677386-64677408 GAGGCTGCCCAGAAGCAAGAGGG - Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
996954179 5:129163896-129163918 GAGGCAGCACAGCTGGGGGTGGG + Intergenic
997284114 5:132666024-132666046 GTGCCTGCAGAGATGCTGGTGGG + Intergenic
997385037 5:133465703-133465725 GTGGCAGCACAGCTGCAGGTGGG + Intronic
997637407 5:135424032-135424054 GAGGTTGCAGAGACGCATGTGGG - Intergenic
997870397 5:137500956-137500978 GGGAGTGCAGAGATGCAGGTGGG - Intronic
998923402 5:147095972-147095994 GTGGCTGCAAAGAGGCAGGAGGG + Intergenic
999060529 5:148629556-148629578 GAGGCTGCAGAGGTTCAGCTTGG + Intronic
999695131 5:154182058-154182080 GAGGCTGACCAGGTACAGGTGGG + Intronic
1000360017 5:160438429-160438451 GATGCTTCAAAGATGCAAGTGGG - Intergenic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1001962845 5:175890647-175890669 GTGGCCGCACAGGTGCAGGAGGG - Intergenic
1002585961 5:180248183-180248205 GAGGCCCCACAGATGAGGGTGGG - Intronic
1003306392 6:4933094-4933116 GAGGCAGCAGAGAAGCAGGAAGG - Intronic
1003858872 6:10303688-10303710 GAGGTCACACAGATGGAGGTGGG - Intergenic
1003940993 6:11026421-11026443 TAGGCTGCCAAGATACAGGTGGG + Intronic
1004409721 6:15369736-15369758 GAGTCTGAACAGATGTAAGTGGG + Intronic
1004885612 6:20049120-20049142 CAGCCTGCACACATGAAGGTAGG - Intergenic
1005352934 6:24954187-24954209 GAGGATGCTCAGAGGCAGGCTGG + Intronic
1005704314 6:28436223-28436245 CAGACTGCAGAGATGCAGGAAGG - Exonic
1005762350 6:28978839-28978861 GAGGCTGTATACATGTAGGTGGG + Intergenic
1006457944 6:34142788-34142810 GAAGCCGCCCAGACGCAGGTTGG + Intronic
1006915595 6:37591911-37591933 GGGGCTCCATAGATGCAGGTGGG - Intergenic
1007341457 6:41193817-41193839 GGGGCTGCAGAGATGAGGGTAGG - Intronic
1015949536 6:138537880-138537902 GGGGCTGCAGAGATCCAGGCCGG + Intronic
1017611523 6:156191311-156191333 GAGGCTGCAGAGAGCCAGGATGG + Intergenic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1019592107 7:1840816-1840838 GAGGCTGCTCAGGTCCAAGTAGG - Intronic
1020608666 7:10368025-10368047 GAGGGTGAGCAGATGCAGGGTGG - Intergenic
1021210525 7:17846837-17846859 GCGGCTCCACAGATACAGGATGG + Intronic
1025689125 7:63744805-63744827 GAGGCTGCTGGGAGGCAGGTAGG - Intergenic
1031162026 7:118180017-118180039 GAGGCTGCAGAGAGCCATGTTGG - Intergenic
1032072811 7:128819282-128819304 CTGGCTGCACAGGTGCATGTTGG - Intronic
1034337401 7:150332340-150332362 GTGGCTGCTGAGATGCAGGTCGG + Exonic
1034658817 7:152751351-152751373 GAGCAGGCACAGATGCAGGGAGG - Intergenic
1035053396 7:156017666-156017688 CAGGATGCACAGAGCCAGGTGGG + Intergenic
1035444353 7:158929645-158929667 GACCCTGCCCAGCTGCAGGTTGG + Intronic
1035599027 8:884269-884291 GAGGCTGCAGAGAAACAGGAAGG - Intergenic
1036167007 8:6444871-6444893 GAGGCTGCAGCTGTGCAGGTCGG + Exonic
1036821852 8:11946948-11946970 GTGGCTGCACAAAATCAGGTGGG - Intergenic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1037838987 8:22230910-22230932 GAGGTGGCACACATGCATGTTGG - Intronic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039826941 8:41182778-41182800 GAGGTTGCACAGATACAGACTGG - Intergenic
1040283867 8:46089611-46089633 GTGGCAGCACAGCCGCAGGTGGG + Intergenic
1040565794 8:48565573-48565595 GTGGCCGCACAGATGCAGGAGGG + Intergenic
1041884434 8:62792171-62792193 GTGGCTGCATAGATGCAGAAAGG - Intronic
1044934210 8:97277678-97277700 CAGGCGGCACAGGTGCAGGCTGG - Exonic
1045825636 8:106394772-106394794 GAGGCTGCACAGATGAACTCTGG + Intronic
1046488875 8:114920902-114920924 GAGGCTACAGAGATGAAGCTAGG - Intergenic
1046528148 8:115407908-115407930 GAGGCAGAACAGATCCAGATAGG - Intergenic
1047431425 8:124796566-124796588 GAGGCTGCACAGTCAGAGGTGGG + Intergenic
1048831675 8:138483513-138483535 GAGGCTGCCCAGATGAAGGTGGG + Intronic
1049104560 8:140603803-140603825 GAGGCCGCACAGTTGCAGGGTGG - Intronic
1049166596 8:141129432-141129454 GAGGGTGCAGAGATGGAGGAAGG - Intronic
1050318728 9:4429293-4429315 GAGGCTGGAGAGAGGGAGGTAGG - Intergenic
1050330933 9:4545517-4545539 GGGGCAGCACAGCTGCAGTTGGG - Intronic
1050382132 9:5041890-5041912 GCGCCTGCAGAGATGGAGGTGGG + Intronic
1050640601 9:7663288-7663310 GATGCTGCACAGATACAGCCTGG - Intergenic
1051303649 9:15682930-15682952 GAGGCTCAACAGATCCAGCTGGG + Intronic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1051900439 9:22032958-22032980 CAGGCTGCACAGCAGAAGGTGGG + Exonic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053070912 9:35101421-35101443 GAGTCTATGCAGATGCAGGTGGG - Exonic
1053414432 9:37938141-37938163 GAGGCTGCACAGATGCAGGTAGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056771977 9:89484163-89484185 GATGCAGCCCAGCTGCAGGTGGG - Intronic
1057015497 9:91647442-91647464 GAGTCTCCACAGATCTAGGTGGG - Intronic
1057275615 9:93674649-93674671 TAGGCTGCACAGATGAGGCTGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1060058262 9:120434660-120434682 GGGGCTGCACAGAGGCAGCCAGG + Intronic
1060588221 9:124799878-124799900 GAGCCTGCTCAGAGGGAGGTGGG + Intronic
1061354877 9:130097059-130097081 GAGGCTGCACAGATCCACAGGGG - Intronic
1061505467 9:131029404-131029426 GTGGCTGCACAGACGCAGGTGGG - Intronic
1061819900 9:133221383-133221405 GGGTGTGCACAGATGCAGGGAGG + Intergenic
1062203682 9:135322796-135322818 GATGCTGAGCAGATGCATGTCGG + Intergenic
1062240756 9:135536565-135536587 GGGTGTGCACAGATGCAGGGAGG - Intergenic
1062480307 9:136747957-136747979 GAGGCTGCAGGGCTGCAGGCTGG - Intronic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186462543 X:9759866-9759888 GAGCCTCCATAGATGCAGTTAGG + Intronic
1187147552 X:16651242-16651264 GAGGGAGGACACATGCAGGTGGG + Intronic
1188366446 X:29321305-29321327 GAGGCTGGAGAGAAGCAGATTGG + Intronic
1190163793 X:48054810-48054832 GAGGCTGCAAAGAAGCATGATGG + Intronic
1192791324 X:74384224-74384246 CAGGCTCCACATATGCAGGAAGG + Intergenic
1194242484 X:91469628-91469650 GAGGGCGAACAGAAGCAGGTGGG + Intergenic
1196950260 X:120869809-120869831 GAGGCTGCAGTGATGGTGGTAGG - Intergenic
1200219356 X:154383563-154383585 GTGGCTGGACAGAGGCAGATGGG + Intergenic
1200972192 Y:9164510-9164532 AGGGCTGCACAGATGAAAGTAGG + Intergenic
1202138838 Y:21699803-21699825 AGGGCTGCACAGATGAAAGTAGG - Intergenic