ID: 1053414928

View in Genome Browser
Species Human (GRCh38)
Location 9:37941500-37941522
Sequence TCCCTCTGTTGGGGGAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053414923_1053414928 -9 Left 1053414923 9:37941486-37941508 CCGCTGTGCAGAGCTCCCTCTGT 0: 1
1: 1
2: 3
3: 41
4: 340
Right 1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG No data
1053414922_1053414928 3 Left 1053414922 9:37941474-37941496 CCATTGTCTTCACCGCTGTGCAG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG No data
1053414920_1053414928 10 Left 1053414920 9:37941467-37941489 CCCAGAGCCATTGTCTTCACCGC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG No data
1053414918_1053414928 22 Left 1053414918 9:37941455-37941477 CCTAAGCCAAGACCCAGAGCCAT 0: 1
1: 0
2: 0
3: 33
4: 316
Right 1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG No data
1053414921_1053414928 9 Left 1053414921 9:37941468-37941490 CCAGAGCCATTGTCTTCACCGCT 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG No data
1053414919_1053414928 16 Left 1053414919 9:37941461-37941483 CCAAGACCCAGAGCCATTGTCTT 0: 1
1: 0
2: 2
3: 15
4: 199
Right 1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053414928 Original CRISPR TCCCTCTGTTGGGGGAGTCA TGG Intronic
No off target data available for this crispr