ID: 1053415405

View in Genome Browser
Species Human (GRCh38)
Location 9:37944193-37944215
Sequence ACATCTCAGAGCCCCCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 242}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053415405_1053415407 -8 Left 1053415405 9:37944193-37944215 CCATGGAGGGGGCTCTGAGATGT 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1053415407 9:37944208-37944230 TGAGATGTCATGAGGTGTGCAGG No data
1053415405_1053415412 28 Left 1053415405 9:37944193-37944215 CCATGGAGGGGGCTCTGAGATGT 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1053415412 9:37944244-37944266 CACTGCAAGTGCAGAAAGTTGGG No data
1053415405_1053415409 4 Left 1053415405 9:37944193-37944215 CCATGGAGGGGGCTCTGAGATGT 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1053415409 9:37944220-37944242 AGGTGTGCAGGCGCCACTGTGGG No data
1053415405_1053415414 30 Left 1053415405 9:37944193-37944215 CCATGGAGGGGGCTCTGAGATGT 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1053415414 9:37944246-37944268 CTGCAAGTGCAGAAAGTTGGGGG No data
1053415405_1053415411 27 Left 1053415405 9:37944193-37944215 CCATGGAGGGGGCTCTGAGATGT 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1053415411 9:37944243-37944265 TCACTGCAAGTGCAGAAAGTTGG No data
1053415405_1053415413 29 Left 1053415405 9:37944193-37944215 CCATGGAGGGGGCTCTGAGATGT 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1053415413 9:37944245-37944267 ACTGCAAGTGCAGAAAGTTGGGG No data
1053415405_1053415408 3 Left 1053415405 9:37944193-37944215 CCATGGAGGGGGCTCTGAGATGT 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1053415408 9:37944219-37944241 GAGGTGTGCAGGCGCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053415405 Original CRISPR ACATCTCAGAGCCCCCTCCA TGG (reversed) Intronic
900174644 1:1286370-1286392 ACCACACAGAGCCCCCTCCTCGG - Intronic
900176367 1:1293133-1293155 ACACCCCAGAGCCTCCTCCCAGG - Exonic
900569834 1:3352813-3352835 AAATTTCAGGGCCGCCTCCAAGG + Intronic
900585442 1:3430400-3430422 AGATCCCAGAGAGCCCTCCAGGG + Intronic
901038443 1:6350049-6350071 GCATCTCAGGGCCCCTTCCGTGG - Intronic
902890384 1:19439040-19439062 ACATCACAGAGCTCCACCCATGG + Intronic
903238139 1:21964042-21964064 AGATCTCAGAGCCTCCTCTTAGG - Intergenic
905800121 1:40837903-40837925 AGACCTAAGAGCCCCCTCCCCGG + Intronic
906667549 1:47632214-47632236 TCAGCTGAGAGCCCCCACCATGG - Intergenic
907108984 1:51909232-51909254 CCCTCTCAGAGCCCTTTCCAAGG - Exonic
907928645 1:58978607-58978629 ACACCTCAGAGGCCCCTCAGAGG - Intergenic
911241373 1:95471040-95471062 ACATCTCAGAGTCTCATCCAGGG + Intergenic
912873144 1:113328198-113328220 ACATCTCTGAGTCTCATCCAAGG + Intergenic
914847811 1:151292511-151292533 ACCTCTGAGAGACCCCTACAAGG + Exonic
915630890 1:157153646-157153668 ACATTTCCAAGCCCCTTCCAGGG - Intergenic
916842561 1:168615019-168615041 ACAGCTCTGGCCCCCCTCCATGG - Intergenic
917613340 1:176712304-176712326 ACATCACTGCCCCCCCTCCAAGG + Intronic
917852837 1:179080130-179080152 ACCACCCAGAGCCTCCTCCATGG + Intergenic
919466621 1:197927923-197927945 AAATCTCAGAACACCCTCTAGGG - Intronic
919567737 1:199209707-199209729 ACCTCTCAGATTCCCCTTCAGGG - Intergenic
923251938 1:232185791-232185813 ACATCACACAGCCCCCGCCCAGG - Intergenic
923267419 1:232328143-232328165 ACATCGGAGAGCCCACTCCTAGG + Intergenic
1064696805 10:17975294-17975316 AAATCTCAGAGCCTCACCCAAGG + Intronic
1066416334 10:35224580-35224602 CCATCTCAGAGCCCGCTCTCTGG + Intergenic
1071824881 10:89315736-89315758 ACAGCTCACAGATCCCTCCAGGG + Intronic
1071962961 10:90824395-90824417 ACATCTCAGAGTCTCATCCAAGG - Intronic
1073288793 10:102403227-102403249 ACAGCTCAGAGCCTCGGCCAGGG - Exonic
1074442119 10:113487192-113487214 AGAACTAAGAGGCCCCTCCATGG - Intergenic
1074803506 10:117025935-117025957 ACATCTCAGAGTCTCACCCAAGG - Intronic
1075642758 10:124076595-124076617 AGATCCCAGAGCCAACTCCAAGG + Intronic
1076078827 10:127559432-127559454 ACTCCACAGTGCCCCCTCCATGG - Intergenic
1076092454 10:127699605-127699627 CCAACGCAGAGCACCCTCCATGG + Intergenic
1076141693 10:128084485-128084507 ACGGCTCTGAGCCCCATCCAAGG + Exonic
1076472335 10:130727880-130727902 AACTCTCAGAGCCCCCGCAATGG + Intergenic
1077037011 11:500118-500140 AGACCCCAGAGCCCCGTCCAGGG - Intronic
1077339896 11:2021587-2021609 CCAACTCAGAGCCGCCACCATGG - Intergenic
1078066436 11:8081832-8081854 ACTGCTCTGAGCCCCCTCCTAGG + Intronic
1079504476 11:21137978-21138000 ACATTTCAAAGGTCCCTCCAGGG - Intronic
1082705551 11:56490578-56490600 GTATCTCAGACCCCCCTCAAAGG - Exonic
1084180051 11:67441660-67441682 ACATCCCAGCAGCCCCTCCAGGG - Intronic
1084659187 11:70537150-70537172 CCCTCTCAGAGTCCCCTGCAGGG + Intronic
1085372302 11:76020357-76020379 ACATCTCAGAGTCTCACCCAAGG + Intronic
1085775544 11:79362927-79362949 ACATCTTAGAGCTCTCTCCCAGG - Intronic
1088503542 11:110507668-110507690 CCACCACAGAGCCCCCTCTATGG + Intergenic
1089074660 11:115728619-115728641 GCATCGCAGCTCCCCCTCCATGG + Intergenic
1091289526 11:134429971-134429993 AAATCACAGACCCCCCTGCAAGG - Intergenic
1202822881 11_KI270721v1_random:76776-76798 CCAACTCAGAGCCGCCACCATGG - Intergenic
1091594985 12:1872236-1872258 AGTTCCCAGAGCCCCCTGCACGG + Intronic
1092298734 12:7224469-7224491 ACACCTCAGAAGCCTCTCCAAGG - Intergenic
1092927108 12:13281309-13281331 CCATCTCAGAGCCCTCACCATGG + Intergenic
1094443727 12:30507437-30507459 AGATCCCACAGCCCCCTCCTTGG + Intergenic
1095375904 12:41528326-41528348 AAGTCTCAGAGGACCCTCCAGGG + Intronic
1095808147 12:46343617-46343639 ACATCTCAGAGTCTCACCCATGG + Intergenic
1096679061 12:53242691-53242713 TCTTCTCAGAGCCTCCCCCACGG + Intergenic
1097264754 12:57738530-57738552 CCATCTCAGCGCCCCCACCCAGG - Intronic
1102561067 12:113762627-113762649 ACATCTCGGAGCCGTCTCCTGGG + Intergenic
1102924297 12:116815149-116815171 ACAGCTCAGAGGCCACTCCCAGG + Intronic
1106654759 13:31731283-31731305 AAATCACAGAGCCACCTCCAAGG - Intergenic
1107726810 13:43307446-43307468 ACATTTTAGAGCCACCTCCCTGG + Intronic
1114268159 14:21084878-21084900 ACATCTCTGACCCCCCTTCAGGG - Exonic
1114601475 14:23958968-23958990 TGATCTCAAAGGCCCCTCCAGGG + Intronic
1114605656 14:23994098-23994120 TGATCTCAAAGGCCCCTCCAGGG + Intronic
1114611165 14:24041737-24041759 TGATCTCAAAGGCCCCTCCAGGG + Intergenic
1115667041 14:35562346-35562368 ACATCTTGGTGTCCCCTCCAAGG - Intronic
1116889060 14:50249674-50249696 ACATCTCAGAGTCTCATCCAAGG - Intronic
1117469548 14:56028457-56028479 ACATCTCAGAGCCCCAGGGAGGG - Intergenic
1118111037 14:62720127-62720149 CCCTCTCTGAGCCCTCTCCAGGG - Intronic
1118431267 14:65720825-65720847 ACATCTAAGTTCTCCCTCCATGG + Intronic
1118972446 14:70648484-70648506 ACATGGGAGTGCCCCCTCCAAGG + Intronic
1120619007 14:86739731-86739753 AAATTTCTAAGCCCCCTCCACGG - Intergenic
1121054926 14:90844664-90844686 ACATCTCAGAGTCAGCCCCACGG - Intergenic
1121866171 14:97364724-97364746 ACATCTCAGGGCCAAATCCATGG + Intergenic
1122324555 14:100874748-100874770 CCATCTCTGAGGCCCCTCCTTGG + Intergenic
1122778258 14:104132559-104132581 GCATTGCAGAACCCCCTCCAGGG + Intergenic
1123569749 15:21591913-21591935 AAATCTCAAAGCCCACCCCAAGG - Intergenic
1123605859 15:22027232-22027254 AAATCTCAAAGCCCACCCCAAGG - Intergenic
1124244664 15:28058817-28058839 GCATCCCAGAGCCCAGTCCAGGG + Intronic
1128780618 15:70356572-70356594 ACATATAAGAGCCCCTGCCAAGG + Intergenic
1129217078 15:74106655-74106677 ACCTCTCAGAACCCCATTCATGG - Intronic
1129262913 15:74378908-74378930 ACATCTCAGGAACCCCTCCCTGG + Intergenic
1129516166 15:76159018-76159040 ACTGCTCAGAACCCCCCCCAGGG - Intronic
1129705292 15:77790824-77790846 CCATGTAAGAGCTCCCTCCAGGG + Intronic
1132404309 15:101533164-101533186 CCATCTCATAACCCCCTTCATGG - Intergenic
1202978097 15_KI270727v1_random:319004-319026 AAATCTCAAAGCCCACCCCAAGG - Intergenic
1133806248 16:9127845-9127867 ACAGCTCAGAGTCTGCTCCATGG + Intergenic
1137292602 16:47061978-47062000 ACCTCTCACAGCCCCCTGCTGGG + Intergenic
1138008881 16:53360073-53360095 TCCTCTCAGAGCTGCCTCCAGGG - Intergenic
1138396783 16:56710487-56710509 GTATCTGAGAGCCTCCTCCAGGG + Intronic
1138654582 16:58483511-58483533 ACATGTAAGAGGCCCCTCAAGGG - Intronic
1143449446 17:7027138-7027160 ACCTCTCAGAGCCCACCCCTAGG - Intronic
1143564980 17:7715786-7715808 ATTTCTCAGAGCCATCTCCACGG - Intergenic
1143733752 17:8896177-8896199 ATATCTCCCAGCACCCTCCATGG + Intronic
1143919212 17:10317594-10317616 ACAGCTCAGAGCACCCTGCAAGG + Intronic
1146635174 17:34498709-34498731 ACATTTTAGAGCACCCACCAAGG - Intergenic
1146666737 17:34710161-34710183 AGAGCTCAGTGTCCCCTCCAAGG - Intergenic
1147211443 17:38874687-38874709 TCTGCTCAGAGCCCCCTGCAGGG + Intronic
1148084891 17:44988048-44988070 CCAGCTCAGGGGCCCCTCCAAGG + Intergenic
1148466125 17:47866298-47866320 CCCTCTCAGAGACCCCTCCCTGG - Intergenic
1148820500 17:50356974-50356996 ACTCCCCAGAGCCCCCTCCCTGG + Intronic
1148885029 17:50766198-50766220 ACAGCCCTGAGCCACCTCCAGGG - Intergenic
1149231276 17:54537081-54537103 ACATCTCAGAGTCTCACCCAAGG - Intergenic
1152074716 17:78151850-78151872 AGATCTCAGAGCCCCTCCCTAGG + Intronic
1152302080 17:79500941-79500963 ACGTCTGAGAGCCCACTCCCTGG - Intronic
1152332406 17:79680763-79680785 AGCTCTCAGAGCCCCCTGCCTGG - Intergenic
1152918038 17:83052001-83052023 ACCTCTCGGAGCCGCCTCCTTGG + Intergenic
1152930057 17:83104826-83104848 CCATCCCAGACCCCCCTCAAGGG - Intergenic
1153129233 18:1835177-1835199 ACATCTCAGAGTCTCATTCAAGG - Intergenic
1153389213 18:4535015-4535037 AAGTCTCAGAGCCTCATCCAAGG + Intergenic
1155704682 18:28793879-28793901 TCATCTCAGGGTCCACTCCAGGG + Intergenic
1155932511 18:31722556-31722578 ACTTCTCAAAGCCGCCTCTAGGG - Intergenic
1159118529 18:64142597-64142619 ACATCTCAGAGCAGCCCTCATGG + Intergenic
1159794510 18:72825203-72825225 ACATCTCAGAGCCCTAACCTGGG + Intronic
1160223711 18:76996569-76996591 ACAGCTTAGAGGCCTCTCCAAGG + Intronic
1160521361 18:79510119-79510141 ATAACTCATAGCCCCCCCCAAGG + Intronic
1161407728 19:4099725-4099747 ACATCTCAGAGGCTGCTCCAAGG + Intronic
1161549251 19:4902283-4902305 ACTTCTCAGAGGCCTCTCAAAGG + Intronic
1163784857 19:19269812-19269834 TAATCTCAGAGCCCCAGCCAGGG + Intronic
1164715533 19:30387923-30387945 TCATCACACAGCCCCCTCCAGGG - Intronic
1164807739 19:31129823-31129845 CCATCTCAGAGCCTGCTTCATGG + Intergenic
1165222154 19:34325283-34325305 ACACATTTGAGCCCCCTCCAAGG - Intronic
1165315979 19:35055680-35055702 ACATCCCAGAGCCTCCTCCCTGG + Intronic
1165324952 19:35109080-35109102 ACGTCCCAGAGCCTCCTCCCTGG - Intergenic
1166708004 19:44919249-44919271 AAATTTCAGAGGCCCCTCCTGGG - Exonic
1166710057 19:44931076-44931098 AAATTTCAGAGGCCCCTCCTGGG - Intergenic
1167349983 19:48968508-48968530 AAATCTGAGATCTCCCTCCAGGG - Exonic
1167769862 19:51508439-51508461 TCCTTCCAGAGCCCCCTCCAGGG - Intergenic
925614491 2:5732541-5732563 ACTTCTCCGTGCACCCTCCAAGG - Intergenic
927240969 2:20919283-20919305 GCATCTCTCTGCCCCCTCCAAGG + Intergenic
928013505 2:27632564-27632586 AAATCACAGAGCCCTCTCCAGGG - Intronic
928314734 2:30236435-30236457 AGTTCTCAGAGCCCCCTCCCAGG + Intronic
929813112 2:45208439-45208461 CTATCTCAGAGTCCACTCCAGGG + Intergenic
929992187 2:46799682-46799704 ACTTCCCAGAGCCTTCTCCATGG + Intergenic
932416018 2:71574355-71574377 ACATACCAGGGCCCCCTCAAGGG - Exonic
933299657 2:80527681-80527703 ACATCTCTGAGGCCTCTCCCTGG + Intronic
934875900 2:97919900-97919922 ACAGCTCAGATCTCCCTACAAGG + Intronic
935653286 2:105399630-105399652 ACATCTTGGATTCCCCTCCAGGG + Intronic
937070092 2:119056729-119056751 ACCTCTCAGACCCTCCTGCATGG + Intergenic
938206924 2:129431935-129431957 ACATCTGACAGCACCCACCATGG + Intergenic
942391788 2:175502685-175502707 ACATCTCAGAGCCTCACCCAAGG + Intergenic
944096692 2:195975935-195975957 ACATCTCAGAGTCTCATCCAAGG - Intronic
945575648 2:211525563-211525585 ACATCTCAGAGTCTCATCTAAGG - Intronic
946071425 2:217037383-217037405 TCATCTCCCATCCCCCTCCATGG - Intergenic
948038770 2:234881889-234881911 ACAGCGCAGCGCCCCCTGCAGGG - Intergenic
1170409143 20:16069651-16069673 ACTTCTCTGAGCTCCCTACAAGG + Intergenic
1172203599 20:33145985-33146007 ACATCTCAGAGTCTCACCCAAGG + Intergenic
1172965332 20:38830105-38830127 ACAGCACAGTGCTCCCTCCATGG - Intronic
1178849378 21:36200472-36200494 AGATCTCGGAGCCCTCTTCAAGG - Exonic
1179061506 21:37983581-37983603 AAATCTCAAAGCTCCCTTCAGGG + Intronic
1179485841 21:41710348-41710370 ACTTCCCAGAGCCTCCTTCAGGG - Intergenic
1180143048 21:45904245-45904267 ACATCTCAGCTCTTCCTCCATGG - Intronic
1180856387 22:19048530-19048552 ACATCTCAGGCTCCCCTCCATGG + Exonic
1181044139 22:20206721-20206743 ACATCTCAGAGCCCACCCATGGG - Intergenic
1181498085 22:23299376-23299398 ACATCACAGACCCCCCTGCACGG + Intronic
1182282447 22:29225262-29225284 ACTGCCCTGAGCCCCCTCCAGGG - Intronic
1184445207 22:44543053-44543075 GCATCACAGAGCCTCCTTCAAGG + Intergenic
1184671120 22:46012818-46012840 CCATCTCAGAACTCCCTCCAGGG - Intergenic
1184850065 22:47114975-47114997 CCATCTGTGAGCCACCTCCAGGG + Intronic
949988198 3:9555741-9555763 GCATCTCAGAGTCCCCTCTGGGG + Intergenic
950473929 3:13204036-13204058 CCATCTGTGAACCCCCTCCAGGG + Intergenic
951029306 3:17863466-17863488 ACATCTCTGAGTCTCATCCAAGG + Intronic
951041241 3:17990904-17990926 CCAGCTCAGAGCCCCATGCAGGG - Intronic
951423103 3:22510778-22510800 AAGTCTCAGAGCCTCATCCAAGG - Intergenic
951804391 3:26628612-26628634 ACATCTCAGAGCTTCCATCATGG - Intronic
952118831 3:30216485-30216507 CCATCTTGGAACCCCCTCCATGG + Intergenic
952958311 3:38574405-38574427 ACCTTCCAGAACCCCCTCCAGGG + Intronic
953824571 3:46239781-46239803 TCATCCCAGAGCTGCCTCCATGG - Intronic
953881364 3:46693044-46693066 ACAGTTCAGCGCCCCCTCCCTGG - Intronic
955987005 3:64584001-64584023 ACATATCCGAGCCCCCCGCAGGG - Intronic
956728114 3:72173300-72173322 ATATCCCAGAGCTCTCTCCATGG + Intergenic
959717008 3:109444188-109444210 ACATCTCAGAGTCTCACCCAAGG - Intergenic
959979675 3:112502142-112502164 ACTTCTCAGATCCCCCTTCAAGG + Intergenic
961667090 3:128499193-128499215 ACACCTCTGAGTCCCTTCCACGG - Intergenic
961992234 3:131204364-131204386 GCTTCTCACAGCCCCCTCCTTGG - Intronic
962078736 3:132114651-132114673 ACATCTCAGAGTCTCACCCAAGG + Intronic
962198162 3:133380657-133380679 CCTTCTCAGCGCCCCCACCACGG + Exonic
962483319 3:135816498-135816520 ACATCTCAGAGTCTCACCCAAGG - Intergenic
962654933 3:137533466-137533488 TCATTTCAGAGCCCTCTCCTGGG - Intergenic
965580119 3:170258809-170258831 ACATGACAGAGCCTCCTCAAAGG - Intronic
966749416 3:183307729-183307751 ACAGCCCAGAGCGCCTTCCAAGG + Intronic
967976955 3:195040858-195040880 ACCTCTCACGGCCCCCTCCCTGG + Intergenic
968484331 4:851646-851668 TCATCTCAGAGCCCAGTCCTGGG - Intronic
968728386 4:2258721-2258743 ACATCTCAGAAGCCCCCTCATGG - Intronic
969642824 4:8409428-8409450 ATATCCCACAGCCCCTTCCAGGG - Intronic
971142339 4:23937784-23937806 ATATCTCAGCTCCTCCTCCAGGG - Intergenic
971506336 4:27370070-27370092 ACCCCTCAGAGCTCCCTTCAGGG - Intergenic
972278448 4:37581366-37581388 ACATCTCAGAGTCTCACCCAAGG + Intronic
973627694 4:52789478-52789500 CCCTCTCAGAGGCCCCTGCATGG + Intergenic
974301020 4:60067379-60067401 ACATCTCAGAGTCTCACCCAAGG - Intergenic
976040707 4:80881325-80881347 GCAACTCAGAGTGCCCTCCATGG + Intronic
976082836 4:81375408-81375430 ACATCTCAGAGTGCCAACCAAGG + Intergenic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
980105515 4:128584603-128584625 ATATCTCAGAGCCATCTCCATGG - Intergenic
985874052 5:2581825-2581847 ACATCTCCAAGCCCTCTCCGGGG - Intergenic
986029122 5:3879332-3879354 TTATCTCAGTGCCCCCTTCATGG - Intergenic
987358695 5:17087176-17087198 ACAGCTCAGGCCCCTCTCCATGG - Intronic
987645873 5:20671909-20671931 ACATCTCAGAGTCTCACCCAAGG - Intergenic
991050988 5:62272689-62272711 ACATCCCTGAGCCTGCTCCAAGG - Intergenic
992240838 5:74767498-74767520 ACTCCTCAGAGCCCACCCCACGG - Intronic
995187777 5:109289957-109289979 ACCTCTGAGAGCTCCCTCCCAGG - Intergenic
995262521 5:110122355-110122377 AAATCTCAGAGTCTCATCCAAGG + Intergenic
995826280 5:116303363-116303385 ACATTTCAGAGCCCCTTGCAGGG - Intronic
996931645 5:128896286-128896308 ACATCTCAGAGTCTCACCCAAGG + Intronic
997073295 5:130642527-130642549 ACATCTAAGAGTCTCATCCAAGG + Intergenic
997373689 5:133382064-133382086 TCATCTCAGAGCCCAGACCATGG + Intronic
998074147 5:139222578-139222600 ACATCTCTGATGCCCCTCCCTGG - Intronic
998632574 5:143916090-143916112 ACATCTGACAGCCCTCTCCTTGG + Intergenic
999891078 5:155979433-155979455 CCATCTCAGAGCCCACTTCCTGG - Intronic
1001259171 5:170212448-170212470 ACTTCTCAGAGCTAACTCCAAGG + Intergenic
1001680183 5:173550978-173551000 ACATCTCAGGGAAACCTCCAAGG - Intergenic
1001873843 5:175182247-175182269 ATATCTCAGAGACCCTTCCCAGG + Intergenic
1002516996 5:179766168-179766190 ACAGCTCTGAGGCCCCTCCTGGG - Exonic
1003644564 6:7904000-7904022 ACCTCTGAGAGCCAGCTCCAGGG - Intronic
1004380485 6:15128256-15128278 ACAAATGTGAGCCCCCTCCATGG - Intergenic
1006824550 6:36925004-36925026 AAACATCAGAGCCTCCTCCACGG + Intronic
1007142045 6:39585880-39585902 ACATCTCAGAGATATCTCCAAGG + Intronic
1008848526 6:55996592-55996614 ACGTCTCAGAGCCTCAACCAAGG + Intergenic
1015578830 6:134701814-134701836 ACATCTCAGAGTCTCATCCGAGG + Intergenic
1017324885 6:153132383-153132405 ATGTCTCAGGGCCTCCTCCAGGG + Intergenic
1018467724 6:164066519-164066541 ACCTCTCACAGCCCTCTCCTTGG - Intergenic
1018997963 6:168724684-168724706 ACTGCTCAGAGCCCCAACCAGGG - Intergenic
1019547278 7:1584587-1584609 ACACCTCAGAGGTCCTTCCAGGG - Intergenic
1020153503 7:5702254-5702276 ACAGCTCCCAGCCTCCTCCAAGG + Intronic
1026916338 7:74122125-74122147 TCATCTCAGAGCCCCTTCCCGGG + Exonic
1027185017 7:75965879-75965901 ACATCTCACAGCCCTTCCCAAGG - Intronic
1028160917 7:87483798-87483820 ACATCTCAGAGTCCTACCCAAGG - Intergenic
1028307957 7:89290232-89290254 ACATCTCAGAGTCTCATCAAAGG - Intronic
1033333740 7:140435389-140435411 CCATCTCCGAGCCCCTTCCACGG + Intergenic
1035060770 7:156067551-156067573 CCATCTCTGAGCTCCATCCAGGG - Intergenic
1035411554 7:158647376-158647398 ACATCACAGTGCCCCCTGCAGGG + Intronic
1036063852 8:5356427-5356449 ACATATCAGAGTCCCCTGTAGGG + Intergenic
1036478988 8:9120942-9120964 ACACCTCTCTGCCCCCTCCAGGG + Intergenic
1038625912 8:29193120-29193142 CCTTCTCACAGCCCCATCCAGGG - Intronic
1038853375 8:31302876-31302898 ACATTTCAGAGCACACTCTATGG - Intergenic
1039084873 8:33770024-33770046 ACTTGTCAGAACCCCCTGCAAGG - Intergenic
1040382071 8:46882642-46882664 ACATCTCAAAACCCCCTCTGTGG + Intergenic
1041251039 8:55935074-55935096 AGATCACAGAGCTGCCTCCATGG - Intronic
1041396159 8:57393714-57393736 ATATCTCAGAGGCTCCTCCATGG - Intergenic
1042060858 8:64815885-64815907 ACTTCTCAGACACCTCTCCATGG - Intergenic
1044066236 8:87703509-87703531 ACATCTCTGAGTCTCCCCCAAGG - Intergenic
1047589260 8:126309788-126309810 ACCACACAGACCCCCCTCCAGGG - Intergenic
1047937984 8:129800488-129800510 ACATCTCAGAGTCTCACCCAAGG + Intergenic
1049501598 8:142970550-142970572 CCATCTCAGAGCCCCACCCTGGG - Intergenic
1049770102 8:144375974-144375996 ACTTCCCAGAGCCCAATCCAGGG - Intronic
1050151463 9:2622409-2622431 ACAGCTCAGAGGCGCCACCACGG - Intronic
1053415405 9:37944193-37944215 ACATCTCAGAGCCCCCTCCATGG - Intronic
1058773777 9:108264439-108264461 TGGCCTCAGAGCCCCCTCCATGG + Intergenic
1060190298 9:121588443-121588465 ACCTCTCAGAGCCTGCTCCTGGG - Intronic
1060514281 9:124256212-124256234 ACATCTATGAGCACCTTCCATGG - Intergenic
1060895105 9:127212181-127212203 TCTTCTCAGAGGCCCCTCCATGG - Exonic
1061393018 9:130328075-130328097 ACATCTCAAAGACCCTGCCAGGG - Intronic
1061893034 9:133632771-133632793 CCATCACAGAGCCCACTCCAGGG - Intergenic
1062178041 9:135175244-135175266 ACCTCTCAGAGCTCCTACCATGG + Intergenic
1062264012 9:135678551-135678573 ACATTTCACAGCCCCAGCCACGG - Intergenic
1062522309 9:136963406-136963428 ACAACCCTGAGCCCCCTCCCAGG - Intergenic
1185894054 X:3843157-3843179 ACTTCTCCGAGCGCCCCCCAGGG + Intronic
1185899172 X:3881581-3881603 ACTTCTCCGAGCGCCCCCCAGGG + Intergenic
1185904289 X:3920010-3920032 ACTTCTCCGAGCGCCCCCCAGGG + Intergenic
1187623567 X:21085851-21085873 ACATCTCAGAGTCTCACCCAAGG - Intergenic
1189849597 X:45165448-45165470 ACATCTCGGAGCCCACTCCAAGG + Intronic
1191700645 X:64038383-64038405 ACATCTCAGAGTCTCACCCATGG - Intergenic
1191715597 X:64191681-64191703 ACATCTCAGAGCTTCGACCATGG + Exonic
1192405980 X:70886996-70887018 ACATCTCAGAGTCTCGCCCAAGG + Intronic
1193455324 X:81724742-81724764 ACATCTCAGGGGCTCTTCCATGG - Intergenic
1193555782 X:82952009-82952031 AAATCTCAGAGCCTCAGCCAAGG + Intergenic
1194033146 X:88840236-88840258 ACATCTCAGAGTCTCACCCAAGG - Intergenic
1194623596 X:96202209-96202231 AAATCTCAGAGGCTCATCCAAGG - Intergenic
1196619591 X:117807000-117807022 ACATCTCTGAGCCTCACCCAAGG - Intergenic
1198808690 X:140513142-140513164 ACCTCTCAGGGACCCGTCCATGG - Intergenic
1199593519 X:149489055-149489077 CCATCTCAGAGTCCCCTCCTGGG - Intronic
1199908448 X:152259755-152259777 AAATCTCAGAGCCTAATCCAAGG - Intronic
1199981426 X:152922665-152922687 AGATGTCAGAGCCTCCTCCCTGG - Intronic