ID: 1053418825

View in Genome Browser
Species Human (GRCh38)
Location 9:37964000-37964022
Sequence CTCTTGAACTAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053418825_1053418833 22 Left 1053418825 9:37964000-37964022 CCTTCTTCCCTCTAGTTCAAGAG 0: 1
1: 0
2: 0
3: 16
4: 207
Right 1053418833 9:37964045-37964067 CCCACCTGCCCAGTGAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053418825 Original CRISPR CTCTTGAACTAGAGGGAAGA AGG (reversed) Intronic
902599299 1:17530282-17530304 TTCTGGAACCAGAGAGAAGAGGG + Intergenic
904752942 1:32752435-32752457 CTCTCCAACTAGAGGCAACATGG - Intronic
907653760 1:56321582-56321604 GTATTGAACTAGAGGAAACAGGG + Intergenic
907907820 1:58800112-58800134 CTCTTAAACTACAGGCAATATGG - Intergenic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
909255268 1:73412679-73412701 CACTTGAAATAGAAGAAAGATGG - Intergenic
909512361 1:76468848-76468870 CTTATGAAGTAGAGGAAAGAAGG + Intronic
909948682 1:81693126-81693148 CTCTTGGAGGAGAGGAAAGAAGG - Intronic
911998748 1:104801807-104801829 ATTTTGAACTATAGGTAAGATGG - Intergenic
913107709 1:115629697-115629719 CTCTGGAACCAGAAGGAAAAGGG - Intergenic
917985117 1:180308695-180308717 CTCTTGAACTAGAAGTAATCAGG - Intronic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
919733063 1:200926610-200926632 CTCTTGAACCTGGGGGGAGAAGG + Intergenic
921067146 1:211631157-211631179 CTGTTGAAAGAGTGGGAAGAGGG + Intergenic
921263761 1:213405771-213405793 CTCTTATACAAGAGGAAAGATGG - Intergenic
921814565 1:219549122-219549144 CTTTTGAACTATCAGGAAGAAGG - Intergenic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
922878334 1:228959083-228959105 TTCTTGCACTTGGGGGAAGAGGG + Intergenic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
1063438128 10:6050828-6050850 CTCTTGCACTAGATTGAAAACGG + Intronic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1065601265 10:27371289-27371311 CACGTGAACTAGATTGAAGAAGG + Intergenic
1066037901 10:31512227-31512249 CCCTTGGAGTAGAGGGAATATGG - Intronic
1069384054 10:67868520-67868542 CTCTTGAACCTGGGAGAAGAAGG - Intergenic
1070508019 10:77132966-77132988 CTCTGGAAATAAATGGAAGATGG + Intronic
1071216593 10:83410432-83410454 ATCTTGAACTAGAAGAAAGTTGG + Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075691366 10:124397008-124397030 CTGTTGAACTACAGGGTATATGG - Intergenic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077846667 11:6032653-6032675 CTGGTGGACTAGAGGGAAGCGGG + Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1079413266 11:20209258-20209280 CACTTGAAAGAGAGGAAAGAGGG + Intergenic
1080813764 11:35733563-35733585 CACTCCAACTAGAGGGAAGTAGG - Intronic
1081430408 11:42970480-42970502 CTCTTGAAAGGGAGGAAAGAAGG - Intergenic
1082664311 11:55955531-55955553 CTCTTGAAGAAGAGTAAAGAGGG - Intergenic
1083238649 11:61369280-61369302 TACTTGACCCAGAGGGAAGATGG + Exonic
1083420364 11:62549060-62549082 CTCTTGGTCAACAGGGAAGAAGG + Intronic
1085322181 11:75582162-75582184 CTCTTGAAGTGGGGGGAAAAGGG - Intergenic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1088461523 11:110088516-110088538 CTCTTCAACTAGAGGAAATCAGG + Intergenic
1088811485 11:113395564-113395586 CTCTAGAAATAGAGGCAGGAAGG - Intronic
1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG + Intronic
1096587136 12:52630064-52630086 CACTTGAACAAGAGGGAAAAGGG - Intergenic
1097647616 12:62255768-62255790 CTCTTGAACTTGAGAGGCGAAGG + Intronic
1099614355 12:84915425-84915447 CTCTTTGACTAGAGGAGAGAAGG + Intergenic
1100952495 12:99866980-99867002 CTCTTAAACAAGAGGAAAAAGGG + Intronic
1101895973 12:108757073-108757095 CACTTGAACTGGAGAGATGAAGG + Intergenic
1102067092 12:109986073-109986095 CTCTTGAACTGGGGAGACGAAGG - Intronic
1102152759 12:110699957-110699979 CTCTTGGACCAGGAGGAAGAAGG - Intronic
1102926372 12:116829344-116829366 CTCTGGAACTTTTGGGAAGATGG - Intronic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1104070872 12:125344407-125344429 CTTTTGGGCTAGAGGGAAAAGGG + Intronic
1104101985 12:125621381-125621403 CTCTTTGAGTAGAGGGAAGGGGG + Intronic
1109861360 13:68202931-68202953 CTCTTGAACTCGAGAGGAGGAGG - Intergenic
1110070551 13:71171699-71171721 ATCTTGAATTAGAGTGAAAATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112862071 13:103843411-103843433 ATCTTACCCTAGAGGGAAGAAGG + Intergenic
1116851162 14:49910814-49910836 TTATTAAACTAGAGGGAAGAAGG - Intergenic
1117172129 14:53111441-53111463 CACGTTAACTACAGGGAAGAAGG - Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1119851930 14:77872486-77872508 TTCTTGAAGAAGAGGGAAGTGGG + Intronic
1121583887 14:95049750-95049772 CTCTTGAACCTGGGGGCAGATGG - Intergenic
1122645622 14:103191521-103191543 CTCTTGGCCTCGAGGGAAGGCGG + Intergenic
1124896130 15:33779085-33779107 CTGCTGAACTAGAGAGAAGGAGG - Intronic
1127999891 15:64181128-64181150 CTCTCCGACAAGAGGGAAGATGG + Intronic
1128341409 15:66825039-66825061 ATCTTGAACAAGAAGGAAGAAGG + Intergenic
1128341664 15:66826553-66826575 ATCTTGAATGAGAAGGAAGAAGG - Intergenic
1128402937 15:67303268-67303290 GCCTGGAACTAGTGGGAAGAGGG + Intronic
1130763096 15:86841174-86841196 CCCTTTAACTAGAAGAAAGATGG + Intronic
1132738800 16:1400769-1400791 CTCTTGAACTCGGGGGGTGAAGG - Intronic
1133089134 16:3389979-3390001 ACCTTGACCTGGAGGGAAGATGG + Intronic
1133911830 16:10073037-10073059 CTCTTGAACTAGGGAGGAGGAGG - Intronic
1134491929 16:14702233-14702255 CGCTTGAACCAGGGGGAAGGAGG - Intergenic
1134497310 16:14741355-14741377 CGCTTGAACCAGGGGGAAGGAGG - Intronic
1134800275 16:17077770-17077792 CACTTGAACTTGGGGGAAGGAGG + Intergenic
1135122373 16:19777582-19777604 ATCTTCAAATAGAGGGAGGAAGG + Intronic
1142859408 17:2751824-2751846 CTCATGAAATGGAGGGAATATGG - Intergenic
1147196258 17:38768819-38768841 CTCTTGACCTAGTGGGAGGCAGG + Exonic
1150459026 17:65331644-65331666 CTCTTGCACAAGAGACAAGAAGG - Intergenic
1152506269 17:80750774-80750796 TTTTTAAACAAGAGGGAAGAGGG - Intronic
1152863096 17:82707274-82707296 CTCTTGAACTCGAGAGATGGAGG - Intergenic
1153417967 18:4870558-4870580 CACCTGAACAAGAGAGAAGAAGG - Intergenic
1154219692 18:12441158-12441180 CACTTGAACTGGAGGGAGGGGGG + Intergenic
1154975618 18:21454741-21454763 CCCTTGACCTTGAGGGAAAAAGG - Intronic
1157298890 18:46465581-46465603 CTTATGAACTGGAGGGAAGATGG - Intergenic
1157422249 18:47556958-47556980 GACTTGGACTAGGGGGAAGATGG - Intergenic
1158024264 18:52877346-52877368 CTATTGGTCTAGAGGGAGGAGGG + Intronic
1158873197 18:61708851-61708873 CAGGTGAACTAGAGGGATGAAGG - Intergenic
1159802727 18:72920888-72920910 CTCTTGAACCAGAGAGATGAAGG + Intergenic
1161558280 19:4956694-4956716 AACTGGAACTAGAGGGAAGCGGG - Exonic
1162432711 19:10638716-10638738 CGCTTGAACTAGAGAGGTGAAGG - Intronic
1163407110 19:17129595-17129617 CTCTTGGACTTGAGGGAGGGCGG + Intronic
1164851987 19:31491654-31491676 GTCATCAACTAGATGGAAGAAGG - Intergenic
1165040189 19:33063596-33063618 CTCAGGACCTAGAGGGAGGAAGG + Intronic
1165874391 19:38995628-38995650 CACTACAACTAAAGGGAAGAAGG + Intronic
1165924454 19:39318628-39318650 CTCTTGGGTCAGAGGGAAGAGGG - Intergenic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166528128 19:43526136-43526158 TTCTTAAACTTAAGGGAAGAGGG - Intronic
1166917357 19:46204408-46204430 CTCTTTACATAGAGGGAATAGGG + Intergenic
1168238640 19:55078599-55078621 CTCCTGAGTCAGAGGGAAGAGGG + Intronic
925095850 2:1201350-1201372 TTCATGAAGTAGAGGGTAGAAGG + Intronic
925483248 2:4300134-4300156 CTCTTCATCTGGAGGGCAGAAGG + Intergenic
925626793 2:5849378-5849400 TTCCTGAATTAGAGTGAAGATGG - Intergenic
926377707 2:12250148-12250170 CTCTTGAACCAGGGAGTAGAAGG - Intergenic
926599071 2:14821947-14821969 CGCTTGAACTCGGGGGAAGGAGG + Intergenic
927460107 2:23291604-23291626 CTCTTGAACATGAGGCAACACGG + Intergenic
927991130 2:27447921-27447943 TTCTAGAGGTAGAGGGAAGAAGG + Exonic
928083366 2:28329189-28329211 TTCCTGAGCTAGAGGGCAGAGGG + Intronic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
932005332 2:67921775-67921797 CTCTAGAACTAAAGCCAAGATGG + Intergenic
932158628 2:69440284-69440306 CTGTTGAACTATAGGGTATATGG - Intergenic
932625849 2:73295255-73295277 CTCTTGAAAAAGAGGGTACAGGG - Intergenic
932850291 2:75178056-75178078 TTCTGGATCTAGAGGGAAGGTGG - Intronic
933553415 2:83803221-83803243 TTCTTCAGCTAGAGGGAACAGGG + Intergenic
937822726 2:126329061-126329083 TTCTTGAACTAGAAGAAATAGGG - Intergenic
939423282 2:142001413-142001435 CTCGTGAAGTATAGGAAAGAAGG + Intronic
939590265 2:144055720-144055742 CTCTGGAACTCGAGGGGACAGGG - Intronic
941595938 2:167477205-167477227 CTTTTGGACAAAAGGGAAGAAGG + Intergenic
943689549 2:190855441-190855463 CTCTCTCACTAGAGGGCAGAAGG - Intergenic
943734467 2:191339275-191339297 ACCTTGGACTAGAGGGTAGAGGG + Intronic
947098940 2:226598017-226598039 CTCTTGAATTAGAGCAAAGATGG - Intergenic
947715989 2:232339058-232339080 CCCTGGACCTAGGGGGAAGATGG + Intronic
947735009 2:232449800-232449822 CCCTGGACCTAGGGGGAAGATGG + Intergenic
948359043 2:237405452-237405474 CTCTTCAACAAGAGGGAATGAGG + Intronic
948570940 2:238916761-238916783 CTCTGGGACTAGAAGGAAGGTGG + Intergenic
1170085916 20:12531385-12531407 GTTTTGAACTTGAGGGAAGAAGG + Intergenic
1172500520 20:35423061-35423083 CTCTTGAACCTGAGAGAAGAAGG + Intergenic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1173641293 20:44603991-44604013 CTCTTGAAGTAGAGGACAGAGGG + Intronic
1175926875 20:62475535-62475557 GTCTTGACCTGCAGGGAAGAGGG + Exonic
1176974931 21:15309734-15309756 CTCTTGAGTTAAAGGTAAGAAGG + Intergenic
1183792446 22:40083744-40083766 CTGTTGAAATAGGGGAAAGAGGG + Intronic
1184778459 22:46634997-46635019 CTTTTGAACTAGAGAGCAGCGGG + Intronic
949402642 3:3682068-3682090 CTCCTTAATTAAAGGGAAGAAGG - Intergenic
949700564 3:6752261-6752283 CTCTGGAACTAGAACCAAGATGG + Intergenic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953532653 3:43752449-43752471 CTGTTGAGCGAGAGGGAATACGG + Intergenic
954355704 3:50082705-50082727 CGCTTGAACCCGAGGGAAGGAGG - Intronic
956271646 3:67454192-67454214 CTCTTTAAGTACAGGGACGAGGG + Intronic
961489149 3:127240499-127240521 TTCTTGAACCTGAGGGGAGAGGG - Intergenic
961692261 3:128678677-128678699 CGCTTGAACTAGGGGGATGGAGG - Intronic
963419868 3:145048108-145048130 CTCCTGTTCTACAGGGAAGAAGG + Intergenic
966175718 3:177136006-177136028 CTATTGGAGTAAAGGGAAGATGG - Intronic
966769083 3:183488247-183488269 CTCCTGTCCTAGAGGGAAGGTGG - Exonic
967099417 3:186203943-186203965 CTCTTAAACTAGAGGGAAAGAGG - Intronic
968238823 3:197056243-197056265 TTATGGAGCTAGAGGGAAGATGG - Intronic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
969706382 4:8794400-8794422 CTCAAGAACTAGAAGGAACAGGG + Intergenic
972837554 4:42892006-42892028 CTCTTGAATTTAAGGGAAAAGGG - Intergenic
973842584 4:54877111-54877133 CATTTGAACTTGATGGAAGATGG - Intergenic
974094682 4:57350738-57350760 CTCTTCAACTTGGGGGAAGCAGG + Intergenic
974611036 4:64215934-64215956 ACCTTAAACTAGAGGGAAGGTGG - Intergenic
974676773 4:65101477-65101499 GTCTTGAAATAGAGGTAATAGGG + Intergenic
975322211 4:73021382-73021404 CTCTTGAGCTAAAAGGTAGAGGG + Intergenic
977007364 4:91586012-91586034 GTGTTGAACTAGAGGGATGGAGG + Intronic
978157311 4:105504829-105504851 CTCATGAACTCCAGTGAAGATGG + Intergenic
978373057 4:108048536-108048558 CTCTTGCAGTAGACGAAAGAGGG + Exonic
978377084 4:108085643-108085665 CTCTTCTGCTAGAAGGAAGAAGG + Intronic
979204973 4:118028156-118028178 CTCTTGAACTACATGGCATAAGG + Intergenic
980504594 4:133699924-133699946 CTCTTTAAATAGAGGGAAGGAGG - Intergenic
981738340 4:147976163-147976185 CTCTTGCACTTGATGGAAAATGG - Intronic
982910807 4:161140520-161140542 CTCTTGAACTTGAGAGGAGGAGG - Intergenic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
984876270 4:184370685-184370707 GTCTTCAACTAGAGGAAATATGG + Intergenic
985019102 4:185668889-185668911 CCCTTGAGCTAGCAGGAAGAGGG + Intronic
985290495 4:188381716-188381738 CGCTTGAACCAGAGAGTAGAAGG - Intergenic
986185236 5:5429509-5429531 ATCTTGGGCTAGAAGGAAGACGG - Intronic
986800278 5:11252909-11252931 CTCTTGATTTAGAGGGGAGAAGG - Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
995046424 5:107653613-107653635 TATTTTAACTAGAGGGAAGAGGG + Intronic
995759901 5:115552017-115552039 CTATTCAAATAGGGGGAAGAGGG - Intergenic
996042294 5:118828861-118828883 TACTTGAACAAGATGGAAGAAGG + Intergenic
998811877 5:145974754-145974776 CTCTTAAACTACAGGGTAGTAGG - Intronic
999467551 5:151822037-151822059 CTCTTGAAGCAGAGGCAAAATGG + Intergenic
1000770504 5:165347440-165347462 TTCTTGACAGAGAGGGAAGAGGG - Intergenic
1000856706 5:166406975-166406997 TTCTTGAGCTAGGGGGAAAAAGG + Intergenic
1002159296 5:177305649-177305671 CTCTTAAACTAGAAGGCAAAAGG - Intronic
1005791558 6:29307817-29307839 CACTTGAATTGGAGGGAGGAAGG - Intergenic
1007339616 6:41182194-41182216 CTTATCAACTAGAGGGCAGAAGG - Intergenic
1007944596 6:45814316-45814338 CTCTGGAAGTAGAGCCAAGAAGG + Intergenic
1009868559 6:69428573-69428595 CCCTATAACTAGAAGGAAGAAGG + Intergenic
1010979010 6:82348921-82348943 CTCTTGAACCCGGGAGAAGAAGG - Intergenic
1011823217 6:91276516-91276538 CTTTGCCACTAGAGGGAAGAAGG + Intergenic
1012668120 6:102004668-102004690 ATGTTGCACTAGAGGGCAGACGG - Intronic
1015066672 6:129038383-129038405 CTCATGATCAAGAAGGAAGATGG - Intronic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016425762 6:143934381-143934403 ATATTGAAAGAGAGGGAAGATGG - Intronic
1016918775 6:149270408-149270430 CTCTTGAACTAAAGAAAAAAAGG - Intronic
1019099231 6:169614262-169614284 TTCTTGACCTAGAAGGAGGATGG - Intronic
1020031883 7:4939116-4939138 CACTTGAACTAGAGAGATGGAGG + Intronic
1022151689 7:27614553-27614575 CTCTTCTACTAGACTGAAGAGGG - Intronic
1022452704 7:30529961-30529983 CTCTTGAAATGAAAGGAAGATGG - Intronic
1022843951 7:34191490-34191512 CTCTTAAACCACTGGGAAGAAGG - Intergenic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1023652912 7:42389747-42389769 CTACTGTACTAGAGGAAAGATGG - Intergenic
1024503828 7:50143496-50143518 CACTTGAACTAGAGAGTAAATGG - Intronic
1025031886 7:55564155-55564177 CTCTCCAACTAAAGGGAAGGAGG + Intronic
1027221549 7:76217366-76217388 CGCTTGAACTTGGGGGAAGGAGG - Intronic
1029690463 7:102177974-102177996 CACTTGAACTCGGGAGAAGAAGG - Intronic
1040641976 8:49345718-49345740 TGCTTGAACCAGAGGGAAGGAGG + Intergenic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1047848643 8:128831764-128831786 TTTTTGAACTTGAAGGAAGAAGG - Intergenic
1048214457 8:132481564-132481586 ACCACGAACTAGAGGGAAGAGGG - Intergenic
1052538410 9:29776928-29776950 CACTTGAATTAGAAGGAAAAAGG - Intergenic
1052744818 9:32430271-32430293 CTCTCCCACTAGAGGGGAGAAGG - Intronic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1056009054 9:82306286-82306308 CTCTTAAGCAATAGGGAAGATGG + Intergenic
1057172362 9:92970554-92970576 CTGTTGAACTACAGGGAATGTGG + Intronic
1058681900 9:107447361-107447383 ATCCTGATCTAGAGGGAAGTGGG - Intergenic
1058710906 9:107678269-107678291 CACTTGAACTTGAGGGAGGATGG + Intergenic
1058948405 9:109880386-109880408 GTGTTGATCTAGAGGGAAGTAGG + Intronic
1060131799 9:121107619-121107641 ATCTTGAAATTGAGGCAAGAAGG - Intronic
1061505053 9:131027081-131027103 CTAATGAACCAGAAGGAAGACGG + Intronic
1189352733 X:40288941-40288963 CACTTCAACTAGGGGGAAGGAGG - Intergenic
1191136215 X:57067946-57067968 GTCATGAACTCCAGGGAAGAAGG + Intergenic
1192996401 X:76517234-76517256 CTCTTGACTTAGAGGTAAGAGGG - Intergenic
1193493024 X:82173042-82173064 CTCTTGGACTAGAGTGTTGATGG + Intergenic
1194722458 X:97356254-97356276 CACTTGAACAAAAGGGGAGAAGG - Intronic
1196198555 X:112860199-112860221 GTATTGAACTAGAGGGAGGGAGG - Intergenic
1197971375 X:132118760-132118782 ATCTTAAACTTGAGGGCAGAGGG - Intronic
1197985222 X:132259596-132259618 CTCCTGGACTACAGGGAACAAGG + Intergenic