ID: 1053422756

View in Genome Browser
Species Human (GRCh38)
Location 9:37990247-37990269
Sequence AGGGTGTTGGAGGTGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053422749_1053422756 -3 Left 1053422749 9:37990227-37990249 CCAGGTACTCTAAACTGTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1053422756 9:37990247-37990269 AGGGTGTTGGAGGTGGTACAGGG No data
1053422747_1053422756 17 Left 1053422747 9:37990207-37990229 CCTCTGTTCAGTTTAGAGCACCA 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1053422756 9:37990247-37990269 AGGGTGTTGGAGGTGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053422756 Original CRISPR AGGGTGTTGGAGGTGGTACA GGG Intronic
No off target data available for this crispr