ID: 1053424409

View in Genome Browser
Species Human (GRCh38)
Location 9:38001681-38001703
Sequence CAGTCTCCTCCCACTCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053424409_1053424415 -2 Left 1053424409 9:38001681-38001703 CCTCTTAGAGTGGGAGGAGACTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1053424415 9:38001702-38001724 TGGCTGGCCACAGAGGGTTAGGG No data
1053424409_1053424412 -9 Left 1053424409 9:38001681-38001703 CCTCTTAGAGTGGGAGGAGACTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1053424412 9:38001695-38001717 AGGAGACTGGCTGGCCACAGAGG No data
1053424409_1053424414 -3 Left 1053424409 9:38001681-38001703 CCTCTTAGAGTGGGAGGAGACTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1053424414 9:38001701-38001723 CTGGCTGGCCACAGAGGGTTAGG No data
1053424409_1053424421 29 Left 1053424409 9:38001681-38001703 CCTCTTAGAGTGGGAGGAGACTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1053424421 9:38001733-38001755 CTTGGAGGCCACATCCTTGCTGG No data
1053424409_1053424413 -8 Left 1053424409 9:38001681-38001703 CCTCTTAGAGTGGGAGGAGACTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1053424413 9:38001696-38001718 GGAGACTGGCTGGCCACAGAGGG No data
1053424409_1053424418 14 Left 1053424409 9:38001681-38001703 CCTCTTAGAGTGGGAGGAGACTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1053424418 9:38001718-38001740 GTTAGGGTTAGTTCCCTTGGAGG No data
1053424409_1053424417 11 Left 1053424409 9:38001681-38001703 CCTCTTAGAGTGGGAGGAGACTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1053424417 9:38001715-38001737 AGGGTTAGGGTTAGTTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053424409 Original CRISPR CAGTCTCCTCCCACTCTAAG AGG (reversed) Intronic
900374486 1:2347190-2347212 GTGTCCCCTGCCACTCTAAGTGG - Intronic
900682393 1:3924179-3924201 CAGACTCCTCCCAGGCTAGGGGG - Intergenic
902400054 1:16152681-16152703 CAGCCTCCTGTCAATCTAAGGGG - Intronic
903847160 1:26285375-26285397 CAGACACCTCCCATTCTGAGGGG - Intronic
905474303 1:38215023-38215045 CCCTCCCCTCCCACTGTAAGGGG + Intergenic
905526431 1:38643489-38643511 CAGTCTCTTCCCTCTGGAAGGGG + Intergenic
909764195 1:79334321-79334343 CAGTCTCCTCCCAGTCACACAGG - Intergenic
910192079 1:84604878-84604900 CAGAGTTCTCCCACTCTCAGAGG - Intergenic
912724316 1:112045157-112045179 CAATGTCGTCCCGCTCTAAGTGG - Intergenic
913211103 1:116583199-116583221 CTGTCTCCTCCCACTCCATCTGG + Intronic
916960497 1:169883469-169883491 CACTCTCCTCCCAATCTGATTGG - Intronic
917901685 1:179549003-179549025 TAGACTTCTCCCACTCTCAGGGG + Intronic
919790951 1:201290588-201290610 GGCTCTCCTCCCACTCAAAGAGG - Intronic
920032964 1:203048416-203048438 CAGCCTCCTCCCACTCTCTGTGG - Intronic
920312004 1:205054072-205054094 CAGCCGCCTCCTGCTCTAAGGGG + Intronic
920334228 1:205233531-205233553 CAGCTTCCTCCCACTGTGAGTGG + Intronic
922757671 1:228105542-228105564 CAGCCTCCTCCCACTATAGTGGG - Intergenic
923054489 1:230415698-230415720 CAGTCCCATCTCACTCCAAGAGG + Intronic
924656822 1:245980042-245980064 CAGTCTCCTCCACCTATAAGTGG + Intronic
1065870925 10:29955858-29955880 CAGTCTTCTCCCACTTTATAGGG - Intergenic
1066274731 10:33857328-33857350 CAGTGTCCTGTCACTCTCAGGGG - Intergenic
1069841556 10:71342681-71342703 CAGTGTCCTCCCAGCCTCAGAGG + Intronic
1070288115 10:75098349-75098371 CCGTCCCCTCCCACTTTCAGGGG + Intronic
1075077421 10:119360449-119360471 CAGACTCCTCCCACTCACACAGG - Intronic
1076682753 10:132182484-132182506 CTGTGTCCTCCCACCCTAGGTGG + Exonic
1079350346 11:19686557-19686579 CAGTCTCCTCTCACTTAAAGGGG + Intronic
1081754983 11:45538192-45538214 CAGCTTCCTCCCCCTCTGAGAGG + Intergenic
1088607802 11:111548103-111548125 CAGTATGCTCCCATTCTAATGGG + Intronic
1091580064 12:1780595-1780617 CAGTCTACTGCCACTCAGAGGGG + Exonic
1092269539 12:7012319-7012341 CATGCTCCTCCCAATCTCAGCGG + Intronic
1096542588 12:52316427-52316449 CAGTCTCTTCCTACACTGAGGGG + Intronic
1096811838 12:54175562-54175584 CAGTCTCCGCCCTCTCTCACAGG + Intronic
1097680958 12:62648368-62648390 CAGTCTCTTCCCAGCCCAAGCGG - Exonic
1100942526 12:99739964-99739986 CTGTCTCCTCCCACTTAATGTGG + Intronic
1102139648 12:110604230-110604252 CAGTCTTCTCCCACTCTTTGTGG - Intergenic
1102735643 12:115156895-115156917 CAGTCACCTCCATCTCTAACTGG + Intergenic
1102903943 12:116660534-116660556 CTGTCACCTCTCACTGTAAGAGG - Intergenic
1105997030 13:25682369-25682391 CAGTCACCTTCCAGCCTAAGAGG + Intronic
1107042604 13:35965729-35965751 CAGACCCCTTCCACTCTTAGGGG + Intronic
1109074980 13:57823341-57823363 CGGCCTCCTGCCACTCTCAGTGG - Intergenic
1110548359 13:76782391-76782413 CTCTCCCCTCCCACTATAAGAGG + Intergenic
1111611974 13:90616690-90616712 CTGTGTCATCCCAGTCTAAGGGG + Intergenic
1111668301 13:91297037-91297059 CAGTCTCCTTCCACTCATGGTGG - Intergenic
1112074435 13:95894921-95894943 CAGTCTCCTCCCTCCCCAAGAGG - Intronic
1113266319 13:108622044-108622066 CAGTATCCTCCCAATCTGTGGGG - Intronic
1119543052 14:75453083-75453105 TAGCCTCCTCCCACTCCAGGAGG - Intronic
1119664721 14:76477181-76477203 CAGGACCCTCCCACTCTAAATGG + Intronic
1123700845 15:22913862-22913884 CAGTCACCTTCCACTCTCTGTGG - Intronic
1125840339 15:42794723-42794745 CAGTCTTCTCCCAGTCAAAAGGG + Exonic
1127736112 15:61840597-61840619 CAGCCTCCTCCCTCACTGAGAGG + Intergenic
1128313288 15:66644890-66644912 CAGTCCCATCCCACGCTGAGGGG + Intronic
1128521487 15:68377896-68377918 CACTGTCCTCCCACTCTGGGTGG + Intronic
1128999497 15:72320258-72320280 CAGTCAACTCCCACTCTGATTGG - Exonic
1130870868 15:87971199-87971221 CTGTTTCCTCCCACTGTCAGTGG - Intronic
1135054072 16:19216038-19216060 CAGGCCCCTCCCACTATATGTGG + Intronic
1137630696 16:49941743-49941765 CTGCCTCTTCCCACTCTAAAGGG + Intergenic
1141620095 16:85232693-85232715 CAGTCTCCTGCCACTGTATGTGG + Intergenic
1141827698 16:86492801-86492823 GAGTTTCCTGCCACTCTGAGAGG - Intergenic
1148901092 17:50877765-50877787 CAGTTTGCTACCACTTTAAGAGG + Intergenic
1150018245 17:61582070-61582092 TAGTCTCTTTCCACTCTAGGAGG - Intergenic
1151999984 17:77639186-77639208 CAGTCTCCAGACACTCAAAGAGG + Intergenic
1155187078 18:23396522-23396544 CGCCCTCCTCCCACTCTAATTGG + Intronic
1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG + Intergenic
1157984291 18:52419674-52419696 CAGGATCCTCTCACTCTAAATGG - Intronic
1162448257 19:10737805-10737827 CTGTCTCCCCCCACTAGAAGGGG + Intronic
1164183173 19:22837621-22837643 CAGTCCTCTCTCACCCTAAGAGG - Intergenic
1165357564 19:35313282-35313304 CAGGCGCCTCTCGCTCTAAGAGG - Exonic
926171911 2:10558010-10558032 CAGCCTCCTCCCACCCTACCTGG + Intergenic
927948886 2:27154308-27154330 CCGTCCCCTCCCACTCTGAAGGG - Exonic
929888425 2:45899114-45899136 CAGTCTCCTTTCACTCAAAACGG - Intronic
930754243 2:54959388-54959410 CAGTCTGCTCTCTCTCCAAGAGG + Intronic
931686187 2:64796151-64796173 CATTCTCAACCCTCTCTAAGCGG - Intergenic
931910580 2:66895457-66895479 CAGGCACCTCCAAATCTAAGAGG + Intergenic
937156736 2:119725146-119725168 CAGTCTCCTCCCACAATCTGAGG + Intergenic
937859769 2:126698435-126698457 CAGTCTGCTCCCAGTCTACTGGG + Intergenic
939090952 2:137779820-137779842 CAGTCTCCTCCAAGGCTTAGAGG - Intergenic
940584399 2:155626705-155626727 CAGCCTCCTCACTCTCAAAGAGG - Intergenic
941377976 2:164754301-164754323 CAGTCTCCTCCCTTTGTACGTGG + Intronic
945670987 2:212802487-212802509 CAGTTTCCTCACACTTTGAGGGG + Intergenic
947863458 2:233379393-233379415 CGGGCTCCTCCCAATCTGAGAGG - Intronic
1169626237 20:7572932-7572954 CAGTCTGCTCCCTCTGAAAGAGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1175916061 20:62426574-62426596 GAGTCTCCTCCCACCCTCTGTGG + Intronic
1178235344 21:30835143-30835165 CACTCTCCTTCCACTCTACAGGG + Intergenic
1180728706 22:17965052-17965074 CAGTTTCCTCCCTCTGTCAGAGG - Intronic
1182129717 22:27842126-27842148 CAGTTTGCCCCCAATCTAAGGGG + Intergenic
1183432729 22:37775334-37775356 CAATCTCTTCCCACTCCACGAGG - Exonic
949409278 3:3746079-3746101 CATTTTCCTCCAACTCTAAAGGG + Intronic
950159135 3:10746354-10746376 CAGTCTCCTCACCTTTTAAGTGG - Intergenic
950773642 3:15332133-15332155 CCGTCTCCTGCCACCCTATGTGG + Intronic
952495703 3:33914026-33914048 CAGTCTCATCTCACTTCAAGAGG - Intergenic
955415009 3:58684047-58684069 CAGTTTCCACCCACACTCAGGGG + Intergenic
956077167 3:65517665-65517687 CAGTCTCATCGCATCCTAAGAGG + Intronic
959906750 3:111718581-111718603 GGGTCTCCTCCCTCTCTCAGTGG - Intronic
959915721 3:111814927-111814949 CAGGTTCCTCCCACACTACGTGG - Intronic
964301735 3:155294764-155294786 CAGAATCCTCCCACTCTCACAGG + Intergenic
967172713 3:186835526-186835548 AAGACTCCTCCCATTCCAAGGGG - Intergenic
968867343 4:3221914-3221936 CAGATTTCACCCACTCTAAGCGG + Intronic
973657145 4:53059958-53059980 GATACTCCTCTCACTCTAAGTGG + Intronic
974156848 4:58084289-58084311 CAGTCTTCTTCCACTCACAGTGG - Intergenic
979678931 4:123438313-123438335 CTAACTCCTGCCACTCTAAGAGG - Intergenic
979865949 4:125754168-125754190 CAGTATACTTCCAGTCTAAGTGG + Intergenic
980020325 4:127701845-127701867 CATTCTCCTCCCACTTTCACTGG - Intronic
981229412 4:142335819-142335841 CTGTCTCCTGCCACTATCAGTGG - Intronic
985166027 4:187095243-187095265 CTGTCTTCTCCCTCTCTCAGTGG + Intergenic
986469767 5:8061988-8062010 CAGTCCCTTCCCACACTGAGTGG + Intergenic
989412965 5:41141248-41141270 CACTCTCTTCTCACTCTAAGTGG - Intergenic
989536772 5:42573265-42573287 TAGACCCCTCCCACTATAAGGGG - Intronic
991732607 5:69603931-69603953 CAGCCTCCGGCCACCCTAAGGGG + Intergenic
991809039 5:70459075-70459097 CAGCCTCCGACCACCCTAAGGGG + Intergenic
991862346 5:71023921-71023943 CAGCCTCCGGCCACCCTAAGGGG - Intronic
993039521 5:82796961-82796983 CAGTCTCTTCCCATTCAGAGAGG + Intergenic
1000315842 5:160089776-160089798 CAGTTTACTCCCACTCCAAGGGG + Intronic
1000775261 5:165412167-165412189 CAGTCTCCTTCCACAAAAAGTGG - Intergenic
1006283043 6:33071139-33071161 CATTCTCCTGTCACTGTAAGTGG - Intronic
1007890818 6:45289553-45289575 CACTCTCCTTCCATTCTTAGTGG + Intronic
1010229138 6:73520176-73520198 CAGTCTCCACCCACTCAGTGTGG + Exonic
1010443024 6:75919988-75920010 GAGTCTCCTTCCACTCTCAGAGG - Intergenic
1012528661 6:100207714-100207736 CAGTCTTTTCCCACACTCAGTGG + Intergenic
1014746941 6:125211580-125211602 CACTCTCATCCCACTCTCAAAGG + Intronic
1016092233 6:139993848-139993870 CATTCTCATCCCAGTCTCAGAGG - Intergenic
1017313042 6:152996856-152996878 CAGTCTACTATCACTCTAACAGG + Intronic
1018335294 6:162780251-162780273 AAGGATCCTCCCACACTAAGAGG + Intronic
1019331019 7:460864-460886 CAAGCACCTCCCACTCAAAGGGG + Intergenic
1023790712 7:43750962-43750984 GAGTTTTCTCCCACTTTAAGTGG + Intergenic
1024074513 7:45811734-45811756 CTGGCTCCTCCCACGCTGAGAGG + Intergenic
1024641027 7:51328633-51328655 TAGTCACCTCCCACACTAACAGG - Intergenic
1029018854 7:97342876-97342898 CAGAGTCTTCGCACTCTAAGGGG + Intergenic
1031009097 7:116505551-116505573 CCTTCTCCTTCCACTATAAGTGG - Intronic
1034892825 7:154855607-154855629 CACCCTCTGCCCACTCTAAGGGG + Intronic
1037770321 8:21795103-21795125 CAGGTTCCTCCCTCTCTAATGGG - Intronic
1040967962 8:53102797-53102819 CTGTCTCCATCCACTTTAAGAGG - Intergenic
1041611124 8:59850984-59851006 CACTCCCCTCCCAGTGTAAGTGG - Intergenic
1043114356 8:76231325-76231347 AAGACTCCTCCAAGTCTAAGGGG - Intergenic
1044853443 8:96451681-96451703 CAGCTTCCTCCCATTGTAAGTGG - Intergenic
1046784679 8:118253056-118253078 CATTCTCCTACCTCTTTAAGGGG - Intronic
1053424409 9:38001681-38001703 CAGTCTCCTCCCACTCTAAGAGG - Intronic
1058785714 9:108384701-108384723 GGGTCTCTTACCACTCTAAGTGG + Intergenic
1060874890 9:127075643-127075665 CAGCCTCCTCTCACCCCAAGGGG - Intronic
1062081899 9:134628548-134628570 CAGCCTCCTCCAACTCCCAGTGG + Intergenic
1185551571 X:986245-986267 CATTCTCCTCCCACAGAAAGGGG + Intergenic
1189534662 X:41923719-41923741 CAGGCTCCGCCCACTCCAACCGG + Intergenic
1190913188 X:54790450-54790472 CACTCTCCTGCCATTCTCAGTGG + Intronic
1193311889 X:80020382-80020404 CACTCTCCCCCCACTTTAATGGG + Intronic
1193380075 X:80808565-80808587 CTTTCCCCTCCCAATCTAAGCGG + Exonic
1197761293 X:130030299-130030321 CCCTGTCCTCCCACTCTAGGGGG - Intronic
1200208773 X:154336243-154336265 CAGTCTCCTCACTCTCTAGTGGG + Intergenic
1200222101 X:154395891-154395913 CAGTCTCCTCACTCTCTAGTGGG - Intronic