ID: 1053424811

View in Genome Browser
Species Human (GRCh38)
Location 9:38003902-38003924
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053424802_1053424811 0 Left 1053424802 9:38003879-38003901 CCACCGGCTGGTTCCCAATTGTG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1053424811 9:38003902-38003924 TGGGGTGGTGAGGCTGTTGCTGG No data
1053424803_1053424811 -3 Left 1053424803 9:38003882-38003904 CCGGCTGGTTCCCAATTGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 114
Right 1053424811 9:38003902-38003924 TGGGGTGGTGAGGCTGTTGCTGG No data
1053424801_1053424811 1 Left 1053424801 9:38003878-38003900 CCCACCGGCTGGTTCCCAATTGT 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1053424811 9:38003902-38003924 TGGGGTGGTGAGGCTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr