ID: 1053425217

View in Genome Browser
Species Human (GRCh38)
Location 9:38005874-38005896
Sequence CAGGCCAGGACTTCTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053425205_1053425217 23 Left 1053425205 9:38005828-38005850 CCTTGGCCACTCCCTGCATACTA 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG No data
1053425211_1053425217 -7 Left 1053425211 9:38005858-38005880 CCCCAGACCAGAAACACAGGCCA 0: 1
1: 0
2: 1
3: 51
4: 540
Right 1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG No data
1053425212_1053425217 -8 Left 1053425212 9:38005859-38005881 CCCAGACCAGAAACACAGGCCAG 0: 1
1: 0
2: 1
3: 28
4: 311
Right 1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG No data
1053425206_1053425217 17 Left 1053425206 9:38005834-38005856 CCACTCCCTGCATACTACTCCTC 0: 1
1: 0
2: 4
3: 35
4: 642
Right 1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG No data
1053425209_1053425217 -2 Left 1053425209 9:38005853-38005875 CCTCTCCCCAGACCAGAAACACA 0: 1
1: 0
2: 2
3: 36
4: 405
Right 1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG No data
1053425207_1053425217 12 Left 1053425207 9:38005839-38005861 CCCTGCATACTACTCCTCTCCCC 0: 1
1: 0
2: 1
3: 22
4: 266
Right 1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG No data
1053425208_1053425217 11 Left 1053425208 9:38005840-38005862 CCTGCATACTACTCCTCTCCCCA 0: 1
1: 0
2: 1
3: 11
4: 247
Right 1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG No data
1053425213_1053425217 -9 Left 1053425213 9:38005860-38005882 CCAGACCAGAAACACAGGCCAGG 0: 1
1: 0
2: 3
3: 18
4: 280
Right 1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053425217 Original CRISPR CAGGCCAGGACTTCTCATGG TGG Intronic
No off target data available for this crispr