ID: 1053425647

View in Genome Browser
Species Human (GRCh38)
Location 9:38008306-38008328
Sequence CTGTGGGCGGGGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 1, 2: 5, 3: 31, 4: 445}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053425647_1053425659 5 Left 1053425647 9:38008306-38008328 CCCACTTCTCTCCCCGCCCACAG 0: 1
1: 1
2: 5
3: 31
4: 445
Right 1053425659 9:38008334-38008356 CGGGTGAGCACCACTGGGCTGGG No data
1053425647_1053425657 0 Left 1053425647 9:38008306-38008328 CCCACTTCTCTCCCCGCCCACAG 0: 1
1: 1
2: 5
3: 31
4: 445
Right 1053425657 9:38008329-38008351 CTCTGCGGGTGAGCACCACTGGG No data
1053425647_1053425658 4 Left 1053425647 9:38008306-38008328 CCCACTTCTCTCCCCGCCCACAG 0: 1
1: 1
2: 5
3: 31
4: 445
Right 1053425658 9:38008333-38008355 GCGGGTGAGCACCACTGGGCTGG No data
1053425647_1053425656 -1 Left 1053425647 9:38008306-38008328 CCCACTTCTCTCCCCGCCCACAG 0: 1
1: 1
2: 5
3: 31
4: 445
Right 1053425656 9:38008328-38008350 GCTCTGCGGGTGAGCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053425647 Original CRISPR CTGTGGGCGGGGAGAGAAGT GGG (reversed) Intronic
900266314 1:1759067-1759089 CTGTTGGCGGGGAGAGCAGGGGG - Intronic
900518292 1:3093650-3093672 CTGTGGTCGTGGTGAGAAGGAGG + Intronic
901372914 1:8816056-8816078 TTGGGGGAGGGGAGAGAAGCTGG - Intronic
901520282 1:9778670-9778692 CTATGGACGGGGGGAGAAGACGG - Intronic
901696618 1:11012621-11012643 CGGTGGGCGGGGGGAGGAGGCGG + Exonic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
902169254 1:14597840-14597862 CTGTGGTCTGGGAGAGAAAGAGG + Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902816453 1:18919166-18919188 CTGTGGGTGGGGGGAGCTGTTGG - Intronic
902919448 1:19657412-19657434 CTGTGGGAGGGGGAGGAAGTTGG + Exonic
903839083 1:26225498-26225520 CTTGGGGCGGGGAGGGAGGTGGG + Intergenic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
904746901 1:32716841-32716863 AAGTGGGCGGGGAGAAAAGGCGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905663790 1:39749359-39749381 GTGAGGGCAGGGAGAGCAGTGGG - Intronic
906542677 1:46599973-46599995 TTGTGGGAGGGGAGAGGAGTTGG - Intronic
906725352 1:48040316-48040338 CTGGGGATGGGGAGAGGAGTGGG + Intergenic
907576863 1:55534562-55534584 CTGTGGCCTGGGAGACAATTAGG - Intergenic
908982942 1:69980363-69980385 CTTCAGGCTGGGAGAGAAGTGGG - Exonic
909941455 1:81616280-81616302 CTGTTGATGGGGAGAGAGGTAGG - Intronic
909969683 1:81966682-81966704 CTGGGGATGGGGAGAGAACTGGG + Intronic
910979845 1:92949143-92949165 GAGTGGGAGGGTAGAGAAGTGGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
914676182 1:149909124-149909146 GTGTGGGCTGGGAGAGAGGTGGG - Intronic
915167143 1:153954269-153954291 CTCTGGGGGAGGAGATAAGTAGG + Exonic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
917629679 1:176879560-176879582 TTGGGGGCGGGGGGAGAGGTGGG - Intronic
919879697 1:201893531-201893553 CTGTGGATGGGGAGAAAAGGAGG - Intergenic
919988843 1:202694797-202694819 GTGTCGGAGGGGAGAGAAGGAGG - Intronic
920234481 1:204493926-204493948 CTGTGGACTGGGTGAGAAGTCGG - Intronic
920838575 1:209534735-209534757 CTGTGGGAGGTGAGAGGACTGGG - Intergenic
921284275 1:213594957-213594979 CTGGGGGTTGGGAGAGAGGTGGG + Intergenic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
923479831 1:234373661-234373683 ACGTGGGCGGGCAGAGAGGTCGG + Exonic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
924273447 1:242359228-242359250 CTGTGAGGTGGGAGTGAAGTAGG + Intronic
924406257 1:243750374-243750396 ATGTGAGAGGGGAGAGAAGGTGG - Intronic
1063939223 10:11109820-11109842 CAGGGGGCGGGGAGAGAGGAAGG - Intronic
1064291956 10:14043430-14043452 CAGTGGGCAGGGAGTGAAATTGG - Intronic
1064453695 10:15467215-15467237 GTGTGGCAGGGGAGAGAAGAGGG + Intergenic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1067093791 10:43285433-43285455 CTGTGAGCAGGGACAGAAGTTGG - Intergenic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069559528 10:69419744-69419766 CTGTGGTGTGTGAGAGAAGTGGG + Intergenic
1070173443 10:73950354-73950376 CAGTGTGCGGGGAGAGAATCTGG + Intergenic
1070871201 10:79754988-79755010 CTGGTATCGGGGAGAGAAGTGGG + Intergenic
1071332091 10:84570875-84570897 CAATGGGCTGGGAGAGAAGCGGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071553774 10:86586699-86586721 CAGTGGGCGGGGAGAGTGGCAGG + Intergenic
1071638135 10:87277196-87277218 CTGGTATCGGGGAGAGAAGTGGG + Intergenic
1071657109 10:87460756-87460778 CTGGTATCGGGGAGAGAAGTGGG - Intergenic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1075595289 10:123724895-123724917 CTGGGTGCTGGGAGAGAAGGTGG + Intronic
1075634342 10:124020055-124020077 CAGCTGGCGGGGAGAGAAGATGG - Intronic
1076726072 10:132413900-132413922 CAGTGGGGTGGGAGAGAGGTAGG + Intronic
1079087836 11:17460028-17460050 CTGTCAGAGGAGAGAGAAGTGGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079545171 11:21625379-21625401 TTCTGGGCAGGGAGAAAAGTGGG - Intergenic
1081180151 11:39974899-39974921 TTGTTGGTGGGAAGAGAAGTTGG - Intergenic
1081692270 11:45086583-45086605 CTGGGGGCGGAGAGAGCAGGAGG - Intergenic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1081825837 11:46050562-46050584 CTCTGGGAGGGGAATGAAGTAGG + Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083296631 11:61718717-61718739 CTGAGGGTGGGGGGAGGAGTAGG + Intronic
1083899497 11:65636743-65636765 CTGGGGGAGGGGGGAGAGGTTGG - Intronic
1084157367 11:67321409-67321431 CTGTGGAGCGGGAGTGAAGTGGG - Intronic
1084322480 11:68381358-68381380 ATGTGGTCGGGGACAGAGGTGGG + Intronic
1085106965 11:73853105-73853127 GTGGGGGCTGGGGGAGAAGTGGG + Intronic
1085795236 11:79533219-79533241 CTGTGGCTGGGGGGAGAAGTGGG + Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1090980425 11:131715649-131715671 CTGGGGGAGGGGATAGAAGGAGG - Intronic
1091449306 12:562592-562614 CTGGAGGCAGGGAGAGGAGTGGG + Exonic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091631054 12:2161278-2161300 CTCTGGGAGGGGAGAGACGGGGG + Intronic
1092174542 12:6394194-6394216 CTGTTGGGGAGGAGAGAAGCCGG - Intergenic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1093414720 12:18907074-18907096 CTGTGGGTGGGGAGAGAGAGGGG - Intergenic
1093493135 12:19726665-19726687 CTCTTGGCGGGGACAGAAGCAGG - Intergenic
1095685551 12:45029516-45029538 GAGTGGGCAGGGAAAGAAGTGGG + Intronic
1096079861 12:48826169-48826191 CTGGGGGCAGGTAGAGGAGTTGG - Intronic
1096148844 12:49296310-49296332 CGGTGGGCGCGGGGAGAAGGGGG + Intronic
1096466621 12:51850245-51850267 ATGTGGGCTGGAAAAGAAGTGGG - Intergenic
1096616141 12:52834524-52834546 CTGGGGGCAGGGGGAGAAGGTGG - Intergenic
1096716106 12:53492744-53492766 GTGGGGGCGGGGAGGGAGGTTGG - Intronic
1097153277 12:56994930-56994952 CTGGGGGTGGGGAGAAATGTTGG + Intronic
1097191386 12:57221181-57221203 ATGTGGGTGAGGAGAGAGGTGGG - Intronic
1097374048 12:58819290-58819312 CTGTTGGCTGAGAGAGAAGCTGG - Intergenic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1097889220 12:64760268-64760290 CGGTGGGCGGTGAGAGGAGAGGG - Intergenic
1099300368 12:80886940-80886962 CTGAAGGCTGGGGGAGAAGTTGG - Intronic
1100587097 12:95990526-95990548 CAGGAGGCTGGGAGAGAAGTAGG + Exonic
1101332990 12:103772050-103772072 CTGTGGGTGGGGGGAGATGGGGG + Intronic
1101536182 12:105618820-105618842 CTGTGTGGGGGGACAGGAGTGGG - Intergenic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102659822 12:114516284-114516306 CTGGGGGTGGGGAGAGAATGGGG + Intergenic
1104104943 12:125650279-125650301 CTGTGAGAGGGTAGAGAACTTGG + Intronic
1104388579 12:128372694-128372716 ATGTGGGCTGAGAGAGAAGTTGG + Intronic
1104649705 12:130522699-130522721 CTGTGCGCAGGGAGAGGAGGAGG + Intronic
1104880182 12:132065291-132065313 CTGTAGGCAGGGAGAGCATTTGG + Intronic
1104964657 12:132503457-132503479 CCCTGGGCGGGGGGAGATGTGGG + Intronic
1106194594 13:27482385-27482407 CTGTTGGCTGGGGAAGAAGTGGG - Intergenic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1106512280 13:30422000-30422022 ATGTGGGAGGGGAGAGAAGGAGG + Intergenic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109492205 13:63116503-63116525 CTAGGGGCGGGGAGTGAAATAGG - Intergenic
1110441553 13:75532115-75532137 CTTTTGGGGTGGAGAGAAGTGGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1114083489 14:19220435-19220457 CTGTGGGCTGGGGGAGCAGCTGG + Intergenic
1114610421 14:24036527-24036549 CTGTGCCCGGGCAGGGAAGTCGG + Intergenic
1115906503 14:38208691-38208713 CTGCGGGACGGGAGAGAAGCTGG + Intronic
1116568721 14:46487403-46487425 TTGTAGGCTAGGAGAGAAGTCGG - Intergenic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118361792 14:65063123-65063145 CTCTTGGAGGGGAGAGAAGATGG + Intronic
1119029165 14:71177992-71178014 CTGGGGGTGGGGACAGAGGTAGG - Intergenic
1119545545 14:75469027-75469049 TTGAGGGAGGGGAGAGAGGTGGG + Intronic
1119866225 14:77977415-77977437 CTGAGAGAGGGGAGAGAAGTGGG + Intergenic
1120898648 14:89556994-89557016 CTGTGGGGTGGGAAAGAACTTGG + Intronic
1121322215 14:92998533-92998555 TTGGGGGCAGGGACAGAAGTAGG + Intronic
1121418151 14:93793378-93793400 GGGGGGGCGGGGAGAGAAATGGG + Intergenic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1122437881 14:101711887-101711909 CGGTGGGTGGGGAGAGATGATGG - Intergenic
1122437893 14:101711927-101711949 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437910 14:101711984-101712006 CGGTGGGGGGGGAGAGATGGTGG - Intergenic
1122437927 14:101712022-101712044 CGGTGGGTGGGGAGAGATGGTGG - Intergenic
1122437934 14:101712042-101712064 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437940 14:101712062-101712084 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437977 14:101712198-101712220 CGGTGGGTGGGGAGAGATGATGG - Intergenic
1122437988 14:101712238-101712260 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437999 14:101712278-101712300 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438118 14:101712710-101712732 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438158 14:101712846-101712868 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438198 14:101712982-101713004 CGGTGGGTGGGGAGAGATCTCGG - Intergenic
1122438302 14:101713382-101713404 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438313 14:101713422-101713444 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1124965357 15:34429269-34429291 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1124981975 15:34575471-34575493 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1125186163 15:36933036-36933058 CTGTGGGTGCTGAGAGAAGGGGG - Intronic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1127263989 15:57346651-57346673 CTGTGGCCAGGGAGAAGAGTAGG - Intergenic
1127617049 15:60696535-60696557 CGGTGGGCTGGGAGAAAAGGAGG - Intronic
1127777764 15:62280997-62281019 CTTTTGGCGGGGTGAGAAGTAGG - Intergenic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1128729868 15:70013889-70013911 GTGTGGGCAGGGAGAGAGGGAGG + Intergenic
1128854842 15:71001313-71001335 TTGTTGGCAGTGAGAGAAGTAGG + Intronic
1129333864 15:74841065-74841087 CTGTGGGCAGGGACAGGACTTGG - Intronic
1129727009 15:77906499-77906521 CCGGGGGCTGGGAGAGGAGTTGG - Intergenic
1129933520 15:79431511-79431533 GTGTGGGGGGGGAGAGAAACAGG + Intergenic
1130255199 15:82322741-82322763 CTGTGGCAGAGGTGAGAAGTGGG + Intergenic
1130381308 15:83374584-83374606 CTGTGGGTTGGGAGACAAATGGG - Intergenic
1130599775 15:85267265-85267287 CTGTGGCAGAGGTGAGAAGTGGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131139268 15:89963912-89963934 CTGTGGGAGGGCAGAGCAGTGGG - Intergenic
1131278419 15:91001618-91001640 CTGTGGGTGGGGAGAAGGGTGGG - Intronic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1134239451 16:12494600-12494622 CTGTGAGCTGGTAGAGAAGATGG - Intronic
1135411254 16:22236296-22236318 CTGCAGGAGGGGAGAGTAGTTGG + Intronic
1135522157 16:23185994-23186016 CTGGGGGCCGTAAGAGAAGTAGG + Intronic
1136109695 16:28057076-28057098 CTGTGGGGGCAGAGAGGAGTGGG + Intronic
1136139362 16:28278766-28278788 CTGTTGTCGGGGTGAGTAGTTGG - Intergenic
1136253918 16:29025555-29025577 CTGGGGGAGGGGAGAGAGTTTGG - Intergenic
1136484975 16:30565864-30565886 CTGGGGTCGGGGAGAGTAGGGGG - Intergenic
1137889641 16:52145560-52145582 CTGGGGGTGGGGCGGGAAGTAGG + Intergenic
1138124374 16:54426767-54426789 GTGTTGGTGGAGAGAGAAGTGGG + Intergenic
1138530272 16:57630967-57630989 CTGTGGGGGGGAAGAGAGGCAGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1141464713 16:84197844-84197866 CTCTGGATGGGGAGAGAAGATGG + Intergenic
1141499476 16:84433835-84433857 CACTGGGTGGGGAGAGAATTGGG - Intronic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1141845711 16:86607529-86607551 CTGTGTGTTGGGAGAGAAGGGGG - Intergenic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1142996107 17:3761521-3761543 CTGTGGGAGGGAAGAGAGGGTGG + Intronic
1143037455 17:4007505-4007527 CTGTGGGGGGGGTCAGAAGAGGG + Intronic
1143115848 17:4581575-4581597 CTGGGGGCAGGCGGAGAAGTGGG + Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144370801 17:14589743-14589765 CTGTGTTCAGGGAGAGAAATAGG + Intergenic
1145014592 17:19387893-19387915 CTGTGGGAGGGGAAAAGAGTGGG - Intergenic
1147241407 17:39093177-39093199 CTGGGGGCAGGGACTGAAGTGGG - Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147365009 17:39953455-39953477 CTGAGGGCGGGGATACAAGGTGG + Intergenic
1147704244 17:42414972-42414994 CAGTGGGAGGGGAGAGGTGTAGG - Intronic
1147979036 17:44263428-44263450 ATGGGGTCAGGGAGAGAAGTAGG - Intronic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148137113 17:45300645-45300667 CTGTGGGCAGGCAGAAAAGGAGG - Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1150000117 17:61430244-61430266 CTGTTGGTGGGGATATAAGTTGG - Intergenic
1151007575 17:70455684-70455706 CAGTGGGTGGGGAGAGGGGTAGG - Intergenic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151445188 17:74159119-74159141 CTGTGGGCAGGGGGAGCACTGGG - Intergenic
1151828573 17:76537132-76537154 CTGAGGCCGGGGAGAGGAGGGGG + Intronic
1151972804 17:77467512-77467534 CGGTGGGAGGGGAGTGGAGTGGG - Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152236381 17:79141176-79141198 CTGTGGCTGGGGACAGAATTGGG + Intronic
1152271002 17:79324834-79324856 CTCTGGGCAGGCAGAGAAGCAGG + Intronic
1152593132 17:81223255-81223277 TTGTGGGCGGGGCGTGAGGTGGG + Intergenic
1152747672 17:82048836-82048858 CCGTGGGCGGAGAGAGAAGCGGG + Intronic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1155038003 18:22041645-22041667 CTGTGGGTGGGTCAAGAAGTTGG - Intergenic
1155173002 18:23280944-23280966 CTGGGGGTGGGGAGAGGCGTGGG - Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155581548 18:27313862-27313884 ATGTGGGTTGGAAGAGAAGTGGG + Intergenic
1155668484 18:28340097-28340119 CTGAGGAAGGTGAGAGAAGTGGG + Intergenic
1155680850 18:28483691-28483713 CTCTGAGCAGGGAAAGAAGTGGG + Intergenic
1156355888 18:36339603-36339625 CCCTGGGCGGGGTGAGGAGTGGG - Intronic
1156904860 18:42340571-42340593 ATGTGCGTGGGGAGAGAACTGGG - Intergenic
1157280576 18:46344351-46344373 CTGGGGGCGGGGGGAGAAGGGGG - Intronic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1157581537 18:48776759-48776781 CTGCGGGTGGGAAGAGAAGATGG + Intronic
1157881472 18:51325039-51325061 CTGTGTGTGGGCAGAGAGGTGGG + Intergenic
1159785137 18:72704641-72704663 CTGTTGGTGGGGTGAGAATTTGG - Intergenic
1160210580 18:76874800-76874822 CTGAGGGCGGTGGCAGAAGTGGG + Intronic
1160816143 19:1036643-1036665 CTGAGAGTGGGGAGAGAAGCTGG - Intronic
1160979816 19:1811783-1811805 CTGTGGGACGGGGGAGAGGTGGG + Exonic
1161199361 19:3005969-3005991 CTGGGGTCGGGGAGAGAAGCAGG + Intronic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1161605359 19:5211921-5211943 CTGTGGGCGGGGTGGGGAGGAGG - Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1163453309 19:17391709-17391731 GAGTGGGCAGGGATAGAAGTGGG - Intergenic
1164579965 19:29428967-29428989 CTGAGGGTGGGCAGAGCAGTAGG + Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1165935395 19:39385550-39385572 GTGGGGCCGGGGACAGAAGTGGG - Intronic
1166324553 19:42041338-42041360 CTGTGCCCTGGGAGATAAGTAGG - Intronic
1166686661 19:44800528-44800550 CTGTAGGCGGAGAGAGGGGTGGG - Intronic
1166858065 19:45792937-45792959 CTGTGGGCGGGGCGAGAAGGTGG + Intergenic
1167035673 19:46993853-46993875 GCGTGGGCCGGGAGAGAAGGTGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167172611 19:47843273-47843295 CTGTGGGTGGACAGAGAAGGGGG - Exonic
1167284745 19:48592699-48592721 CTGTGGGCAGAGGGACAAGTGGG - Intronic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167470402 19:49672537-49672559 CTGGGGGCGAGGGCAGAAGTAGG + Intronic
1168097302 19:54123062-54123084 GTGAGGGCGGGGAGAGGAGGAGG + Intronic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
1168692632 19:58386188-58386210 CTGGGGGAAGGGACAGAAGTTGG + Intergenic
925049197 2:798009-798031 CTGTGGCCCGGCAGAGAAGGAGG - Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925407139 2:3613161-3613183 CTGCAGGCGGGGAGGGAGGTAGG + Intronic
925635539 2:5938267-5938289 TTGGGGGCGGTGAGAGGAGTTGG - Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
925908971 2:8559166-8559188 CTGTGGGCTAGGAGAGAAAGTGG + Intergenic
926250913 2:11155202-11155224 CTGGGGGCGGGGCGAGATGAGGG + Intronic
926718074 2:15940479-15940501 CGGGGGGCGGGGAGAGAAGGGGG - Intergenic
926991810 2:18688244-18688266 CTGGGGTCGGGGAGCGGAGTTGG + Intergenic
927256530 2:21044580-21044602 CTGGGGGAGGAGAGAGAAGGGGG + Intergenic
927472027 2:23384501-23384523 CTGTGGTGGGGGTGAGTAGTCGG + Intergenic
927605266 2:24481199-24481221 CTGTTGGTGGGGAGAGAGGATGG - Intergenic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
930218920 2:48726016-48726038 CTGTGGTGGGGGAGAGGGGTGGG - Intronic
930576086 2:53150517-53150539 GTGTGGGTGGGGAGAGAGGGAGG + Intergenic
931180254 2:59892300-59892322 ATGGGGGCGGGGTGAGGAGTGGG + Intergenic
931630886 2:64297647-64297669 CTGGGGGCCAGGAGAGATGTGGG - Intergenic
931755975 2:65374928-65374950 CTGGGAGAGGGGAGAGAAGCGGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
934668015 2:96187502-96187524 CTGTTGACTGGGAGCGAAGTTGG - Intronic
934875592 2:97916505-97916527 CTGTGGCTGAAGAGAGAAGTGGG - Intronic
935064841 2:99638550-99638572 CTGTGGGCGGGGGGACAGCTGGG - Intronic
935401446 2:102664551-102664573 GTGTGGGCGGGGAGAGGAGGTGG + Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937901100 2:127019778-127019800 CTCTGGGAGGGAAGAGAAGGAGG + Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
938730505 2:134143386-134143408 AAGTGGGCAGGGAGTGAAGTGGG + Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939866606 2:147480079-147480101 CTGTGGTAGGGAAGAGAAGTTGG - Intergenic
942124008 2:172805081-172805103 CTGTGAGAGGGGAAAGCAGTGGG - Intronic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
946532423 2:220585889-220585911 CTGTGGCTGGGTAGAGAATTGGG - Intergenic
947437292 2:230083655-230083677 CTGGGGGAGGGGGGTGAAGTGGG - Intergenic
947854099 2:233311641-233311663 ATGGGGGCAGGTAGAGAAGTGGG - Intronic
948768102 2:240233662-240233684 CTGTGGGCGGGGTCAGAGGAGGG - Intergenic
1168752182 20:290456-290478 ATGTGGGCGGGGAGAGGACGGGG + Intronic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1172520047 20:35560411-35560433 CTGAGAGCGGGGTGAGGAGTGGG - Intergenic
1172662214 20:36575079-36575101 GGGTGGGCGGGTACAGAAGTTGG + Intronic
1173558471 20:43984834-43984856 CTGGGGGAGGGGATAGCAGTGGG + Intronic
1173648056 20:44645999-44646021 CTGTGGGCGCAGAGTGAGGTTGG - Intronic
1173672075 20:44805814-44805836 CTGGGGGTGTGGAGAGAAATCGG + Intronic
1174327369 20:49790035-49790057 CTCTGGTCGGGGAGGGAAGTAGG - Intergenic
1175159790 20:56999747-56999769 CTGTGGGAGGGGACAGAACATGG - Intergenic
1175944606 20:62552814-62552836 CTGGGAGCGGGGAGAGGAGGAGG - Intronic
1177713283 21:24807543-24807565 CTGTGGGTCAGCAGAGAAGTAGG + Intergenic
1177789885 21:25711390-25711412 CTATGGGCGTAGAGAGAAGATGG + Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179899397 21:44381187-44381209 CTGCGGACGAGGAGAGAAGCAGG + Intronic
1180024811 21:45154965-45154987 CAGTGGGAGGGGAGAGAGATGGG + Intronic
1180057172 21:45364998-45365020 CTGTGGGCGGGAAGAGCAGATGG + Intergenic
1180294486 22:10872832-10872854 CTGTGGGCTGGGGGAGCAGCTGG - Intergenic
1180497292 22:15902246-15902268 CTGTGGGCTGGGGGAGCAGCTGG - Intergenic
1181136021 22:20766826-20766848 CACTGGGCCGGGAGAGAGGTGGG + Intronic
1182288203 22:29260241-29260263 TTGGGGGTGGGGGGAGAAGTGGG + Intronic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183299586 22:37052222-37052244 CTGTGGACAGGGAGAGACCTGGG + Intronic
1183415145 22:37677367-37677389 GGGAGGGCGGGGAGAGGAGTGGG + Intronic
1183597154 22:38819437-38819459 CTGTGGGCTGGGAAAGGGGTCGG + Exonic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184735294 22:46394432-46394454 CTGTGGGTGGGGGGTGAGGTTGG - Intronic
1185139555 22:49092701-49092723 CTGTGGGCGGGAAGAGGGGAAGG - Intergenic
1185204244 22:49528666-49528688 GTCTGGGCGGGGAGAGTAGGAGG + Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
949371390 3:3338285-3338307 CTCTGGGAGGAGATAGAAGTGGG - Intergenic
949386644 3:3509921-3509943 CAGGGGGTGGGGAGAGAAGGGGG + Intergenic
950095329 3:10325804-10325826 CTGTTGAGGGGGAGACAAGTTGG + Exonic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
951534676 3:23729862-23729884 GAGTGGGCAGGGTGAGAAGTAGG - Intergenic
953885548 3:46712692-46712714 CTGTTGGAGGTGAGAGGAGTGGG - Intronic
954224526 3:49173464-49173486 CTGGGGTGGGGGAGAGGAGTAGG + Intronic
954782793 3:53073298-53073320 CTGTGGGTGAGGAGAGAACCTGG + Intronic
955153908 3:56396900-56396922 CTGTGGGAGATGAGAAAAGTGGG - Intronic
955413727 3:58673099-58673121 CTGTGGGTGGGCAGAGGTGTAGG + Intergenic
956794346 3:72704448-72704470 CTGACAGCGGGGAGAGGAGTAGG + Intergenic
956820185 3:72947261-72947283 CTGTAGACGGGGAGAGAATTAGG + Intronic
959551900 3:107669445-107669467 ATGTGGGTGGGGAGTGAGGTGGG + Intronic
960499726 3:118422693-118422715 CTTGGGGCGGGGAGTGAAGCTGG - Intergenic
960690202 3:120338903-120338925 CTGTGGGCAGGAATAGAAGGAGG + Intronic
961591830 3:127986963-127986985 CTGTGGGAGGCAAGATAAGTGGG + Exonic
961771426 3:129252860-129252882 GTGTGGGCTGGGAGATAGGTGGG - Exonic
962299846 3:134229651-134229673 CTGGGGGAAGGGAGAGATGTTGG + Intronic
962680608 3:137796066-137796088 CTGGGGTCGGGGTGGGAAGTAGG - Intergenic
963692884 3:148526649-148526671 CTGGGGGCTGTGAGGGAAGTGGG + Intergenic
965640766 3:170826372-170826394 CTGGGGGCGGGGGGAGATGGGGG + Intronic
968293206 3:197554963-197554985 CGGAGGGCGGGGAGAGAGGGGGG + Intronic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968981645 4:3853413-3853435 CTCTGATCGGGGAGAAAAGTGGG - Intergenic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
970182332 4:13412352-13412374 CTGGGGGTGGGAGGAGAAGTGGG + Intronic
970420089 4:15897984-15898006 CTCGGGGAGGGGAGAGATGTTGG - Intergenic
972597653 4:40544356-40544378 CGGTGGCGGGGGAGAAAAGTGGG - Intronic
973159128 4:46993824-46993846 CTGTGGGCGGGGAGCCCACTTGG - Exonic
973741727 4:53925400-53925422 GTGTGGGTGGGGACAGAGGTGGG - Intronic
976158105 4:82169501-82169523 TGGCGGGTGGGGAGAGAAGTGGG + Intergenic
977591480 4:98832203-98832225 CTGGGGGCGTGGACAGAAGGAGG + Intergenic
981342496 4:143637906-143637928 TGGTGGGTGGGGAGAGAAGAAGG + Intronic
981851715 4:149239197-149239219 GTGGGGGTGGGGAGAGAACTAGG + Intergenic
982376729 4:154699275-154699297 TTGGGGGCTGGGAGAGGAGTAGG + Intronic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986903969 5:12470625-12470647 CTGTGGTCTGAGAGAGCAGTTGG - Intergenic
987419395 5:17700912-17700934 CTGTTCGCGGGGTGAGAAGAAGG + Intergenic
987506200 5:18776331-18776353 CTGTGAGAGGTGTGAGAAGTTGG + Intergenic
991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG + Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
993440767 5:87954281-87954303 CTGTGGCAGGGGTGAGGAGTAGG - Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
994844362 5:104967925-104967947 GTGGGGGCGGGGAGAGATTTAGG - Intergenic
995723608 5:115163482-115163504 CTGTGGGCTGGGATGGTAGTGGG - Intronic
997564208 5:134874663-134874685 CGGTGCGCGGGGAGAGAAGTCGG - Intronic
998148642 5:139744803-139744825 CTGTGGTCTGGGAGCCAAGTGGG - Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999037889 5:148373953-148373975 ATGTGGGCGTGGGGAGAAGCAGG - Intergenic
1001840323 5:174870691-174870713 AACTGGGCAGGGAGAGAAGTAGG - Intergenic
1002807122 6:587963-587985 GTGAGGGAGGGGAGAGAAGCAGG + Intronic
1002924297 6:1595851-1595873 GTGGAGGCGGGGAGAGAAGAGGG - Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004116384 6:12771832-12771854 CTCTGGGGAGGGATAGAAGTTGG + Intronic
1004204081 6:13574959-13574981 CAGTGGGCGTGGAGAGGGGTCGG + Intronic
1004976509 6:20973413-20973435 CAGTGAGCGGGGAGTGAAGTAGG + Intronic
1005486159 6:26301897-26301919 CAGTGGCTGGGGAGAGAAGCAGG - Intergenic
1006175628 6:32119797-32119819 GTGTTGGGGAGGAGAGAAGTAGG - Intronic
1006787934 6:36680240-36680262 CTTTGGGCGTGGAGATAAGGTGG + Intronic
1006980125 6:38140962-38140984 GTGGGGGCGGGCAGAGAAGCTGG - Intronic
1007167468 6:39839025-39839047 CTGTGGGAGGAGAGAGAGGGGGG - Intronic
1007285545 6:40744822-40744844 CTGGGGGTGGGGAGAGAAAAAGG - Intergenic
1007387208 6:41528096-41528118 AACTGGGCGGGGAGGGAAGTGGG - Intergenic
1007389773 6:41544355-41544377 CTGAGGGTGGGGTGAGAACTAGG - Intergenic
1007418734 6:41706810-41706832 GTGTGGGCGGGGGGAGATGGGGG - Intronic
1008210586 6:48719534-48719556 CTGAGGCTGGGAAGAGAAGTGGG - Intergenic
1008336693 6:50314671-50314693 CTGTGGGAGGAGAAAGCAGTGGG + Intergenic
1013668193 6:112369600-112369622 CTGTGGAGGGGAAGAGAAATTGG + Intergenic
1014443689 6:121502074-121502096 TTGTGGGAGGGTAGAGAACTGGG + Intergenic
1016739607 6:147513384-147513406 GGGTGGGAGGGGAGAGAGGTTGG + Intronic
1018089619 6:160334297-160334319 CTGTGTGGGGAGGGAGAAGTTGG - Intergenic
1019108303 6:169688355-169688377 CTTTTGGGGAGGAGAGAAGTGGG + Intronic
1019519046 7:1452420-1452442 CTGGGGGCGGGGAGAGAGGGAGG - Intronic
1019609893 7:1931059-1931081 CCGTGGGTGGGGTGAGGAGTTGG - Intronic
1019727802 7:2612576-2612598 CTGTGGGCGGGGCGAGCTGTGGG + Exonic
1019982769 7:4633660-4633682 AGGTGGGCGGGGACAGAGGTGGG - Intergenic
1020286143 7:6682660-6682682 CTGGGGTCGGGGAGAGCAGCTGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020409386 7:7874300-7874322 GGGTGGCCGGGGAAAGAAGTGGG - Intronic
1021534499 7:21688209-21688231 CTGTGAGGGGAGAGAGATGTAGG - Intronic
1021820435 7:24492775-24492797 TTGGGGGTGGGGAGAGAGGTTGG - Intergenic
1022090002 7:27102004-27102026 GAGTGGGCTGGGAGAGAAGGAGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024317784 7:48036976-48036998 CTGTAGGAGGGTAGAGAAGAGGG + Intronic
1024655832 7:51450772-51450794 CAGAGGGTGGGGAGAGAATTAGG + Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1027846590 7:83385626-83385648 CTATGGGGTGGGACAGAAGTAGG + Intronic
1028796422 7:94908152-94908174 CTGAGCGCGGGGCGAGGAGTTGG + Intronic
1029226272 7:99030769-99030791 ATGTGGGAGGGGAGAGGAATGGG + Intronic
1029236195 7:99121542-99121564 CTGGGGGCGGGGAGAAGAGGAGG - Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1031680522 7:124667900-124667922 CTTTGGGAGGGGAGAGGAGCAGG - Intergenic
1031993368 7:128212039-128212061 GGGTAGGCGGGGAGAGAAGAGGG - Intergenic
1032151351 7:129432859-129432881 ATGTGGGTGGGGAGAGGAGTGGG + Intergenic
1034350392 7:150411348-150411370 CTCTGGGCAGGGTGAGAGGTCGG + Intronic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1034430810 7:151040382-151040404 GTGTGGGCGGGCAGAGGAGCTGG + Intronic
1034468534 7:151243815-151243837 CCTTGGGCGGGCAGACAAGTGGG - Intronic
1035151450 7:156876612-156876634 CTGTGGTCAGGGAGAGTACTTGG - Intronic
1035447469 7:158952604-158952626 CTGTGGACAGGGAGAAAAGGAGG + Intronic
1035520815 8:273922-273944 CTGGGTGAGGGGTGAGAAGTGGG + Intergenic
1036030698 8:4968602-4968624 CTGAGGGAGGGGAGAGAAACTGG - Intronic
1036432153 8:8701838-8701860 CGGTGGGCGGGGAGGGAAAGAGG - Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037632531 8:20671342-20671364 CTGTAGGATGGGAGAGAATTGGG + Intergenic
1037912905 8:22754769-22754791 GTGAGGGAGGGGAGAGATGTGGG - Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039365761 8:36926422-36926444 CTGATGGAGGGGAGAGATGTGGG - Intronic
1039742563 8:40395937-40395959 CTGAGGGAGGGTAGAGAAGGGGG + Intergenic
1040698294 8:50029500-50029522 CAGAGGGCAGGAAGAGAAGTGGG - Intronic
1041006716 8:53503049-53503071 TTGTGGCAGGGGAGAGATGTGGG - Intergenic
1041627873 8:60051814-60051836 CTGTGAGTGGGGTGGGAAGTGGG - Intergenic
1041788282 8:61660278-61660300 ATTTGGGCAGGGGGAGAAGTAGG + Intronic
1043633884 8:82367643-82367665 GGGGGGGCGGGGAGAGAAGATGG + Intergenic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047192395 8:122690111-122690133 GTGTGGGCGGGGAGAGGGGGCGG - Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047645080 8:126861735-126861757 TTAATGGCGGGGAGAGAAGTGGG + Intergenic
1048451461 8:134537465-134537487 CAGTGGACCGGGAGAGATGTGGG + Intronic
1048851527 8:138649779-138649801 CTGAGAGTGGGGAGAGAGGTGGG + Intronic
1049425376 8:142535734-142535756 CTGTGGGCGAGCAGAGGAGCTGG - Intronic
1049752093 8:144289770-144289792 CTGGGGGCTGGAAGAGAAATGGG + Intronic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1054531257 9:66184784-66184806 CTGTGGCCGGGGAGACAGGCAGG + Intergenic
1056944561 9:90983508-90983530 CAGGGGGTGGAGAGAGAAGTAGG - Intergenic
1057071104 9:92100726-92100748 CTGGGGGCTGGGGGAGAAGGCGG - Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058432256 9:104929485-104929507 CTGGAGGTGGGAAGAGAAGTAGG - Intergenic
1058767128 9:108192467-108192489 CTGAGGGTGGGGAGAGAATCAGG - Intergenic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059483189 9:114607995-114608017 CTGTGGGTGGGGAGAGGCTTGGG + Intergenic
1060101778 9:120847057-120847079 CTCTGGGTGAGGAGAGAAGCAGG - Intergenic
1060104650 9:120866097-120866119 CTGTGGGTGGGTAGAGACGGGGG + Intronic
1061207939 9:129175187-129175209 CTGTGGCCGGGGAAAGCAGCCGG - Intergenic
1061375085 9:130219511-130219533 CTGTGTGGGGGGTTAGAAGTGGG - Intronic
1061541096 9:131278100-131278122 CTGTGTGCGGGGAGCGAGGGTGG - Intergenic
1061923852 9:133796579-133796601 CTGTGGGCGGGGGTACAGGTGGG - Intronic
1061957162 9:133969766-133969788 TGGGGGGTGGGGAGAGAAGTGGG - Intronic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1185509484 X:652444-652466 ATGTGAGCTGGGAGGGAAGTGGG + Intronic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186730407 X:12403539-12403561 CGGCGGGCAGGGAGAGGAGTGGG - Intronic
1189269253 X:39739316-39739338 CTGTGGGCGTTGAGCGCAGTGGG + Intergenic
1189317223 X:40064600-40064622 CTGGGGGAGGGGAGACAAGAGGG + Intronic
1189732359 X:44034458-44034480 GTGTTGGTGGGGAGAGAAGAGGG - Intergenic
1190013383 X:46804976-46804998 CTGGGGGCAGGGAGTGAGGTGGG - Intergenic
1190018524 X:46850721-46850743 CTGGGGCGGGGAAGAGAAGTGGG - Intronic
1190789559 X:53686369-53686391 CTGGGGGAGGGGAGAGGAGGCGG + Intronic
1191898108 X:66014922-66014944 CTGTATGCCAGGAGAGAAGTTGG + Intergenic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1196584334 X:117411809-117411831 CTGTGGTCTGAGAGAGTAGTTGG - Intergenic
1196713978 X:118793605-118793627 CTGTGTGTGAGGAGAGAAATGGG - Exonic
1198424103 X:136497484-136497506 CGGTGGGCGGGCAGAGAGGGGGG + Intronic
1198657921 X:138934983-138935005 CTGAGGGCAGGGGGAGAAGAGGG - Intronic
1198822075 X:140659250-140659272 CTATTTGCGGGGAGAGATGTAGG + Intergenic
1199880753 X:151972981-151973003 CTGTTGGTGGTGTGAGAAGTGGG + Intronic
1200344553 X:155435569-155435591 CTGTGGGCAGGGGGAGGGGTGGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic