ID: 1053426249

View in Genome Browser
Species Human (GRCh38)
Location 9:38012066-38012088
Sequence GAGGAGCCCCTGGGAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053426239_1053426249 20 Left 1053426239 9:38012023-38012045 CCTGTGGAGAGGATAAGCTGAGG 0: 1
1: 1
2: 3
3: 15
4: 203
Right 1053426249 9:38012066-38012088 GAGGAGCCCCTGGGAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053426249 Original CRISPR GAGGAGCCCCTGGGAGAAAC AGG Intronic
No off target data available for this crispr