ID: 1053426361

View in Genome Browser
Species Human (GRCh38)
Location 9:38012729-38012751
Sequence TGCCCTCCGTGTGCCGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053426361 Original CRISPR TGCCCTCCGTGTGCCGCAGG TGG (reversed) Intronic
900616624 1:3568407-3568429 TGGCCTCCGTGGGCCCCATGAGG - Intronic
900970465 1:5989877-5989899 TGCCCTCCTAGTACAGCAGGGGG - Intronic
901646284 1:10718487-10718509 TGCCCTCCTTGGGGAGCAGGTGG - Intronic
906168644 1:43706321-43706343 TTCCCTCCCTGGGCCCCAGGAGG - Intronic
911091321 1:94019533-94019555 TCCCCTCCGTGGGCCCAAGGTGG - Intronic
911664623 1:100539209-100539231 CGCCCTCTGGATGCCGCAGGAGG + Exonic
912827971 1:112923732-112923754 TGCCCTCCTGGTGCAGCTGGTGG - Intronic
915735299 1:158080811-158080833 TTGCCTCCGTGTGCTGCAGGTGG - Intronic
921432743 1:215082827-215082849 TGCCCTCCGTGCCCCGCGGGGGG - Intronic
922605797 1:226889108-226889130 TGCCCTCCTTGTGCAGCACTGGG - Intronic
924194729 1:241594189-241594211 TGCCCATCGTGTGCCACAAGTGG + Exonic
1071600920 10:86958384-86958406 TGCCCTCCATGGGCTGGAGGGGG - Intronic
1076643863 10:131937893-131937915 TGCCCCGCGTGTGCTGCACGGGG - Intronic
1076852370 10:133099368-133099390 TGCCCTCCTGGTGACTCAGGCGG - Intronic
1077047420 11:552616-552638 GACCCTCCGTGGGCCCCAGGGGG - Exonic
1083771505 11:64870175-64870197 TGGCCTCTGTGTGTCTCAGGAGG + Intronic
1084392885 11:68890300-68890322 TGTTCTCCGCGTGCAGCAGGGGG - Intergenic
1089189052 11:116641166-116641188 TGTCCTCCATGTGGGGCAGGAGG - Intergenic
1089729023 11:120509098-120509120 TGCTCACCGTGTGCCTCAGCTGG + Intergenic
1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG + Exonic
1094569645 12:31630380-31630402 TTCCCTCAGTGTTCGGCAGGTGG - Intergenic
1102681713 12:114695029-114695051 TGTCCTCTGTGTGCCCCAGAGGG + Intergenic
1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG + Intronic
1106409508 13:29501431-29501453 TCCCCTCCCAGTGCTGCAGGAGG - Intronic
1111890322 13:94073538-94073560 TGTCCTCCCTCTGCAGCAGGAGG + Intronic
1112370972 13:98793014-98793036 TGCACTCCCTGTGCCCCACGTGG - Intergenic
1113886966 13:113666129-113666151 TGCCCCCGGTGTGTCTCAGGTGG + Intergenic
1121253020 14:92513656-92513678 GGGCCTCCGTGTGCCCCAGGGGG + Intergenic
1122330677 14:100910411-100910433 TCCCCTCCCTGAGCCTCAGGTGG - Intergenic
1122789897 14:104179757-104179779 TGCCATCCCGGGGCCGCAGGAGG + Exonic
1122828951 14:104386392-104386414 TGTCCTCCGTGTGCGCCTGGTGG + Intergenic
1123705567 15:22948339-22948361 TGCCCCCTGTGTGCCGCTGGTGG - Intronic
1124026606 15:25972716-25972738 TGCTCTGCGTTTGCTGCAGGTGG + Intergenic
1132885831 16:2181596-2181618 TGCCCTGAGTGGGGCGCAGGGGG + Exonic
1133178228 16:4032365-4032387 TGCCCTCCACCTGCCGCAGGGGG - Intronic
1135549248 16:23385658-23385680 TGCCCACCGTGTCCCACATGAGG + Intergenic
1137553951 16:49458534-49458556 TGCCATCCTTGGGCAGCAGGTGG - Intergenic
1139576162 16:67843403-67843425 TGGCCTCAGTGAGACGCAGGTGG - Exonic
1141700450 16:85639817-85639839 TGCTTGCCGTGTGCAGCAGGCGG + Intronic
1143408716 17:6695868-6695890 TGCCCTCAAGGTGCTGCAGGAGG - Exonic
1144512671 17:15890901-15890923 TGCTCTCCATGTGCAGCACGAGG + Intergenic
1152103601 17:78316500-78316522 TGGCCTCCTTCTGCCACAGGAGG - Intergenic
1152312671 17:79560384-79560406 TGCCCTCCCTGTCCTGCTGGCGG + Intergenic
1152829411 17:82487971-82487993 TGCCTTCCATCTGCCGCAGCAGG - Exonic
1156462086 18:37326759-37326781 TGCCCACCCCCTGCCGCAGGTGG - Intronic
1157307106 18:46525312-46525334 TGCCCTCCGGTTGCCACAGCTGG - Intronic
1160989149 19:1853497-1853519 TGCCCTCCCTGGCCTGCAGGTGG - Exonic
1161563248 19:4985436-4985458 GGCCCTCCGTGGGCTCCAGGCGG + Intronic
1163314242 19:16531546-16531568 AGCCCTCAGCTTGCCGCAGGGGG + Intronic
1163317800 19:16553516-16553538 GGCCCCCCGTGAGCCGCAGGAGG - Exonic
1164965524 19:32479788-32479810 TGCCCACGGTGTGCTGCAAGTGG + Intronic
1166198403 19:41220888-41220910 TGCCCTCTGTGTGACGGAGGTGG - Intronic
1166893071 19:46006501-46006523 TGCCCTCCGTGTGGCAGTGGCGG + Intronic
927963943 2:27257757-27257779 TGCCCTGCGTGTGCCTGAGAAGG - Intronic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
940045104 2:149401482-149401504 AGCCCTCTGTGAGCCCCAGGTGG + Intronic
940076611 2:149749042-149749064 TGGCTTCCTTGTCCCGCAGGTGG + Intergenic
944801193 2:203239208-203239230 TGCCCGCTGCGGGCCGCAGGGGG + Intronic
948166477 2:235866539-235866561 TGCCATCAGTGTGCTGGAGGGGG + Intronic
1169492782 20:6085330-6085352 CCCCCTCTGTGTGCAGCAGGGGG - Intronic
1173841402 20:46159541-46159563 TCCCCTCCCTGTGCCCCAGCTGG - Intergenic
1174198246 20:48788509-48788531 TGTGCTCTGTGTGCCTCAGGTGG - Intronic
1178481783 21:32985791-32985813 TTCCCTCCGTGTGTCACAGCAGG - Intergenic
1180975409 22:19845306-19845328 TGCCCTGTGGGTGCTGCAGGTGG + Intronic
1183731656 22:39621830-39621852 TCCCCTCCCTGTGCCCAAGGGGG - Intronic
1184478729 22:44735392-44735414 AGACCTCCGTGTTCCCCAGGAGG + Intronic
950000020 3:9649547-9649569 TCCCCTCAGTGTGCCTCAAGCGG - Exonic
950553717 3:13682695-13682717 CCCCCTCCGTCTGCCCCAGGAGG + Intergenic
950702810 3:14761761-14761783 TGCCATGTGTGTGCCACAGGTGG - Intronic
954419471 3:50411026-50411048 TTCCCTGCCTGTGCCTCAGGAGG - Intronic
954606784 3:51917160-51917182 TGCCCTCCCTCTCCCTCAGGAGG + Intergenic
962820556 3:139044398-139044420 TGCCCTGCGTGTGCCCCTGGAGG - Exonic
968225501 3:196969754-196969776 GCCCCTCCGCGTTCCGCAGGCGG + Intergenic
968741892 4:2335283-2335305 TGCCCCCCGGGTCCCTCAGGAGG - Intronic
968910075 4:3473074-3473096 AGCCCTCAGTGTGGCCCAGGGGG + Intronic
970591909 4:17566983-17567005 TGCCCTGTGTCTGCTGCAGGGGG + Intergenic
971480246 4:27108588-27108610 TGCCCTGCGTGGGCCCCAGCAGG + Intergenic
986007151 5:3677723-3677745 TGCTCCCCATGTGCTGCAGGAGG - Intergenic
986551253 5:8958518-8958540 TCCCCTTCGTGAGCTGCAGGAGG + Intergenic
992502318 5:77355113-77355135 TGCTCTCCCTGTGAGGCAGGAGG - Intronic
1004562065 6:16760827-16760849 CTCCCTCCGGGTGGCGCAGGGGG - Intronic
1005221611 6:23594523-23594545 TGCCCTCATTGTGCAGCAGCAGG + Intergenic
1005479361 6:26240795-26240817 AGCCCTTCGTGTGACGAAGGAGG - Intergenic
1005585032 6:27268105-27268127 TGCTCTCCGCGTGCCGCAAAAGG + Intergenic
1013233360 6:108175993-108176015 TGGCCTCCGAGGGCCGCAGGAGG - Intronic
1018872848 6:167796412-167796434 TCCTCTCCTTGTGCTGCAGGAGG - Intronic
1019146089 6:169976459-169976481 TGTCCTCCCTCTGCCGCAGCAGG - Intergenic
1019540158 7:1547705-1547727 TGCGCTCCGGGTGCCCCAGCTGG + Intronic
1023033223 7:36108988-36109010 TGCCCTCCTTATTCCCCAGGTGG + Intergenic
1026523582 7:71136154-71136176 TGCCCTCCGCCTGCTGCAGTGGG + Intronic
1026880742 7:73905295-73905317 TGGCCTCCATGTGCTGTAGGGGG - Intergenic
1029109819 7:98207261-98207283 TTCCTTCCGTGTACCCCAGGCGG - Exonic
1038801169 8:30750383-30750405 GGCCCTCCTTGAGCCCCAGGAGG + Intronic
1046794518 8:118356481-118356503 TTCCCTCCCTGAGCTGCAGGTGG - Intronic
1049158927 8:141084909-141084931 GGCCCTCCCGGGGCCGCAGGAGG - Intergenic
1049213930 8:141399136-141399158 AGCACACCGTGTGCCACAGGAGG - Intronic
1049709656 8:144057803-144057825 TGCCCTCCGCTTGCCGCCGCAGG - Intronic
1053349952 9:37407210-37407232 TGCCCTGCGTCTGCAGCAGCGGG + Intergenic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1053749303 9:41236443-41236465 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1054254744 9:62801294-62801316 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1057810923 9:98256007-98256029 TTCCCTCCCTGTGCCGCGCGGGG + Intergenic
1061761388 9:132854387-132854409 CACCCTCCTTGTGCCCCAGGAGG + Intronic
1062075257 9:134585168-134585190 TTCCTTCCGTGTACCCCAGGCGG + Intergenic
1196723900 X:118878814-118878836 TGCCCTCCTGGTGTCGCTGGTGG + Intergenic