ID: 1053426516

View in Genome Browser
Species Human (GRCh38)
Location 9:38013807-38013829
Sequence GGTCCCATGGAGCCACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053426516_1053426527 29 Left 1053426516 9:38013807-38013829 CCTGCCTGTGGCTCCATGGGACC 0: 1
1: 0
2: 2
3: 26
4: 230
Right 1053426527 9:38013859-38013881 GGCAAGCCACTTACTTCTATTGG No data
1053426516_1053426524 8 Left 1053426516 9:38013807-38013829 CCTGCCTGTGGCTCCATGGGACC 0: 1
1: 0
2: 2
3: 26
4: 230
Right 1053426524 9:38013838-38013860 TGTCCCATGTTCTGCACTCAGGG No data
1053426516_1053426523 7 Left 1053426516 9:38013807-38013829 CCTGCCTGTGGCTCCATGGGACC 0: 1
1: 0
2: 2
3: 26
4: 230
Right 1053426523 9:38013837-38013859 CTGTCCCATGTTCTGCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053426516 Original CRISPR GGTCCCATGGAGCCACAGGC AGG (reversed) Intronic
900124235 1:1062456-1062478 GGCCCCATGCAGGCAGAGGCTGG - Intergenic
900232238 1:1565623-1565645 GTTCCCATGGAGCCACATCGTGG - Intronic
900298976 1:1967325-1967347 CGTCCTATGGAGCGACAGACAGG + Intronic
900419680 1:2550477-2550499 GGTCCCCTGGGGCCCCATGCTGG + Intergenic
900425543 1:2576794-2576816 GGTCCCCTGGGGCCCCATGCTGG - Intergenic
900717086 1:4152170-4152192 AGTCCCCTGAAGCTACAGGCTGG - Intergenic
900780512 1:4614742-4614764 AGTCCCAAAGAGCCACAGGAGGG - Intergenic
900900021 1:5509858-5509880 GTGCCCAGGGAGCCCCAGGCCGG - Intergenic
900928254 1:5719512-5719534 GGGACCATGAAGCCACAGGTGGG - Intergenic
901453339 1:9349364-9349386 GGCCCCATCGTGCCACAAGCAGG - Intronic
902384209 1:16067216-16067238 GGCCCCATGATGTCACAGGCTGG + Intronic
902722018 1:18310052-18310074 AGGCACATGCAGCCACAGGCGGG - Intronic
903225637 1:21893009-21893031 GTTCCCTTGGAGCCAGAGGCCGG + Intronic
912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG + Intergenic
912442760 1:109712020-109712042 GGACTCATGGAGCCTCAGGGCGG + Intergenic
914196717 1:145451607-145451629 TGTCCCACGGGGCCACATGCTGG - Intergenic
914325841 1:146615435-146615457 TGTCCCTTGGAGCCCCAGGTTGG + Intergenic
915741074 1:158118782-158118804 GGTGCCTGGGACCCACAGGCTGG - Intergenic
918375821 1:183908239-183908261 AGTCACATTGAGACACAGGCAGG + Intronic
919737094 1:200959504-200959526 GGCCCCCTGGAGCCACAGGCAGG - Intergenic
919801892 1:201359276-201359298 AGTGACATGGAGACACAGGCAGG + Intronic
920206776 1:204298009-204298031 GGTCCCATGGAGCCAGTAGTTGG + Intronic
920498253 1:206470567-206470589 GGCCCCTAGGACCCACAGGCAGG - Exonic
922561507 1:226572927-226572949 GGTCCCATGGTGGCAGAGCCAGG + Intronic
922791501 1:228313716-228313738 GGTCCCATCCAGCCACCAGCGGG - Intronic
924657175 1:245983458-245983480 GGTCCCAGGGGGCCACGTGCTGG - Intronic
1062911834 10:1216657-1216679 TGCCCCATGCAGCCACAGCCTGG + Intronic
1062951475 10:1507012-1507034 GGTCCCTGAGTGCCACAGGCTGG - Intronic
1063287473 10:4706085-4706107 TGTCCAGTGGTGCCACAGGCTGG - Intergenic
1063387138 10:5623121-5623143 AGTCCCAGGGAGCCACGGGCTGG - Intergenic
1063593505 10:7412598-7412620 TGTCACATGGAGTGACAGGCCGG - Intergenic
1063954213 10:11251084-11251106 AGTATCATGGAGCCAAAGGCAGG - Intronic
1064267216 10:13834739-13834761 TGTCCCATGGCAACACAGGCTGG - Intronic
1067213652 10:44282149-44282171 GGACCCTTGGAGCCTCAGGATGG - Intergenic
1069712932 10:70501309-70501331 GGTTCCATGGAGGCCCAGGGAGG - Intronic
1071502981 10:86216721-86216743 GGTTCCATGGGGCCCCAGGCAGG + Intronic
1071570605 10:86694667-86694689 GATCCCATGGACCCAGAGGCAGG + Intronic
1071710487 10:88044397-88044419 GGTCCCATGGAGCAGCAGAGAGG - Intergenic
1074864461 10:117536859-117536881 TGACGCATGGAGCCACTGGCAGG - Intergenic
1075092736 10:119452615-119452637 GGGCCACTGGAGCCGCAGGCGGG + Intronic
1076202247 10:128567996-128568018 AGTGCCAGGGAGCCACAGGGCGG + Intergenic
1076544400 10:131235083-131235105 GGGCCCAGGGTACCACAGGCAGG + Intronic
1077271151 11:1682129-1682151 GGCCCCAGGGAAACACAGGCTGG + Intergenic
1083378231 11:62243603-62243625 GGTCACCTGGGGCCACAGGGTGG + Intronic
1083796342 11:65018866-65018888 AGGCCCATGGTGCCAGAGGCAGG + Intronic
1084672078 11:70613091-70613113 TGTGCCATGGAGTCACATGCTGG + Intronic
1085312618 11:75525446-75525468 GGTCTCGTGAAGCCAGAGGCTGG + Exonic
1085316485 11:75548207-75548229 GGTCTCAGGGAGCCCCAGGAGGG + Intergenic
1085533172 11:77203472-77203494 GGTCCCATGAGGCCAGGGGCTGG - Intronic
1085691517 11:78667982-78668004 TGTCCCAGGGTCCCACAGGCAGG - Intronic
1087264319 11:96044000-96044022 TGGCCCATGGAGACAAAGGCAGG + Intronic
1089095823 11:115919294-115919316 GGTCCCAGGAAGGCACAGGAAGG + Intergenic
1089466668 11:118690245-118690267 GGTCCCGCGGAGCCACCGGGGGG - Intergenic
1089660578 11:119982713-119982735 GGTCCCATGAACCCACACACAGG - Intergenic
1090264056 11:125343032-125343054 GTTCCAAGGGGGCCACAGGCTGG + Intronic
1091603326 12:1930771-1930793 GCTCACATGAAGCCAGAGGCAGG + Intergenic
1092226086 12:6749142-6749164 GGTCCCAGGAAGCCACCGGTAGG + Intronic
1092344121 12:7701331-7701353 GCTCTCAGGGAGGCACAGGCGGG + Intergenic
1095990237 12:48029551-48029573 GGTCCCCTGCAGCCCCAGTCAGG - Intergenic
1096532321 12:52249711-52249733 GGTACTGTGGAGCCACAGGGAGG + Intronic
1098222339 12:68283348-68283370 TGTCCCACGGAGCCTGAGGCTGG - Intronic
1102561287 12:113764050-113764072 GGCACCTTGGAGGCACAGGCTGG + Intergenic
1104417335 12:128606325-128606347 GGTTCCCTGGAGCCACCGCCTGG + Intronic
1106554295 13:30796918-30796940 GGAGCCATGGAGCCACAAGCTGG - Intergenic
1117817279 14:59611239-59611261 GGGGCCATTGAACCACAGGCAGG - Intronic
1119261843 14:73242310-73242332 CCTGCCATGGAGCCACAGCCTGG - Intronic
1121520454 14:94582741-94582763 GGTCCCATGGAGAGAGAGGCCGG + Intronic
1121649986 14:95550825-95550847 GGACCCATGGATCAAAAGGCAGG - Intergenic
1121789341 14:96687233-96687255 GGTGTCAGGGAGCCCCAGGCTGG - Intergenic
1122152311 14:99731728-99731750 GGGCCCATGGAGCCCCATCCAGG - Intergenic
1122414143 14:101540777-101540799 GGGCCTCTGGGGCCACAGGCTGG + Intergenic
1123076373 14:105669342-105669364 GGCTCCAGGCAGCCACAGGCTGG - Intergenic
1202872429 14_GL000225v1_random:177243-177265 GTTCCCAGGGAGCCCCAGCCCGG + Intergenic
1123782933 15:23645231-23645253 GGACCCATGGAACTGCAGGCAGG + Exonic
1125466531 15:39958593-39958615 GGTTCCATGGAGGCATAGACTGG + Intronic
1128345404 15:66849827-66849849 GCTCCCCAGGAGCCACAGTCTGG + Intergenic
1128651187 15:69414697-69414719 GGCCCCTTGGAGGCCCAGGCGGG - Intronic
1132179041 15:99737892-99737914 GGGGCTATGGAGCCACAGTCTGG - Intergenic
1132326101 15:100971826-100971848 GATCCCATGGAGGCAAAGACTGG - Intronic
1132598172 16:762588-762610 GGGCCCATGTGGCCCCAGGCTGG + Intronic
1132628064 16:901815-901837 GGTTCCTTGCAGACACAGGCGGG - Intronic
1132744384 16:1430632-1430654 GGTCCCAGGGACCCCCAGCCAGG - Intergenic
1133291151 16:4722068-4722090 GGTGCCAAGGAGACGCAGGCAGG + Intronic
1133330017 16:4967087-4967109 GGTCCCACAGAGCCACAAACCGG + Intronic
1134063616 16:11213213-11213235 AGTGACATGGAGCCACAGCCTGG + Intergenic
1134293797 16:12926619-12926641 GGTGCCATGGAGCCAGAAGGAGG + Intronic
1136412097 16:30083573-30083595 TGTCCCATGGAGCCCTGGGCTGG - Intronic
1138410711 16:56837732-56837754 GGTCCCATGGAGCCAGCTCCTGG - Intronic
1138432414 16:56977519-56977541 GGTCCCCTCGTGCCACAGCCTGG + Intronic
1138445572 16:57061165-57061187 AGTCCCATGCACCCAGAGGCTGG + Intronic
1139436160 16:66937824-66937846 GGCCCCAAGGAGCCTCAGCCTGG + Intronic
1139477623 16:67210540-67210562 GGGCCGATGGAGCCTCAGGCTGG + Exonic
1139590178 16:67928985-67929007 GGTCCCACTGAGCCTCAAGCTGG + Exonic
1140007724 16:71095507-71095529 TGTCCCTTGGAGCCCCAGGTTGG - Intronic
1140706537 16:77635675-77635697 AGCCACATGGAGCCACAAGCAGG - Intergenic
1142850658 17:2703261-2703283 GGGCCCACGGAGGCAGAGGCAGG - Intronic
1143183763 17:4998781-4998803 GGTCCACTGGGGCCACAGGAGGG + Intronic
1144646154 17:16975004-16975026 AGTCCCATGGAAGCACAGTCTGG - Intergenic
1144718153 17:17448848-17448870 GGTTCCATGGAGCCCCAGGGTGG - Intergenic
1145780062 17:27557009-27557031 TGTCCCATGGGGCCACTGGCAGG - Intronic
1147466386 17:40614415-40614437 GATACCATGGTGCCTCAGGCTGG + Intergenic
1147696439 17:42358299-42358321 AGTCCCATGGAGGCTGAGGCAGG + Intronic
1148449263 17:47764478-47764500 TGTTCCATTGAGCCACAGGAAGG - Intergenic
1149686582 17:58539007-58539029 GGCCCCATGCAGCCTCAGGATGG - Intronic
1151744166 17:76002633-76002655 GGCCACAGGGTGCCACAGGCAGG + Intronic
1151763784 17:76121959-76121981 GGTTGCCTGGAGCCACGGGCCGG - Intergenic
1151979201 17:77498865-77498887 GCTGCACTGGAGCCACAGGCAGG + Exonic
1158192746 18:54849150-54849172 GGGCCCATGGAGGTTCAGGCAGG - Intronic
1158600693 18:58853508-58853530 GGTGCCATTGAGTAACAGGCTGG + Intergenic
1161060877 19:2214196-2214218 GGTGTCATGGAGCCACACTCTGG + Intronic
1161299358 19:3535381-3535403 TGTCTCTTGGATCCACAGGCTGG - Intronic
1161345603 19:3767483-3767505 GGTCACATGGAAACCCAGGCTGG - Exonic
1161592233 19:5134082-5134104 GGTCCCAGAGAACCCCAGGCAGG + Intronic
1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG + Exonic
1162734408 19:12738078-12738100 TGTCCCAGGCAGCTACAGGCAGG + Intronic
1163476945 19:17532143-17532165 GGTCCCGTGATGCCCCAGGCTGG - Intronic
1164570445 19:29371016-29371038 GGCCCCATGGAGCCACCAGCAGG + Intergenic
1165032446 19:33007952-33007974 GGTCCCCTGGTGCCACCGGGTGG + Intronic
1165668542 19:37655291-37655313 GTTCCTGTGGAGCCTCAGGCCGG - Exonic
1165939429 19:39407806-39407828 GGTCCCGAGGAGCCCCAGCCTGG - Exonic
1166898880 19:46042770-46042792 TATACCATGGAGCCACAGGCTGG - Intronic
1167437190 19:49486339-49486361 GGTCCCCTGGAGCCCCGGGCCGG + Intergenic
1167639979 19:50675883-50675905 GGTCCCAGGGAGGCTGAGGCAGG + Intronic
1167747982 19:51364024-51364046 GGTGCTGGGGAGCCACAGGCAGG + Intronic
925203231 2:1985879-1985901 GCACCCATTGAGGCACAGGCTGG - Intronic
925990345 2:9249708-9249730 GGTCTCCTGGAGCTGCAGGCAGG + Intronic
927117238 2:19916939-19916961 GGTCCCAGGGACCCACTGGGAGG - Intronic
927351952 2:22126136-22126158 GGTCCAAAGGAGACAGAGGCAGG - Intergenic
929044349 2:37775584-37775606 GGTCCCATTGAGCCTCAGCCTGG - Intergenic
929568082 2:43002248-43002270 GCTCACATGCAGCCACAGGTTGG - Intergenic
930403920 2:50929796-50929818 GTTCCCATGGTGGCACAGGATGG + Intronic
930713383 2:54570303-54570325 AGTAGCATGGAGACACAGGCTGG + Intronic
931592001 2:63894671-63894693 GGTCTCATGGTCACACAGGCTGG - Intronic
932449292 2:71799308-71799330 GGTCTCATGGACCCAAGGGCTGG - Intergenic
932793395 2:74674771-74674793 GGAGCCATGCAGCCAAAGGCGGG - Intronic
934079076 2:88452359-88452381 GGGCCCGTTGAGCCACAGGTAGG + Exonic
935632323 2:105222467-105222489 GGGCACATGGAGCCAAGGGCCGG - Intergenic
936293633 2:111248317-111248339 GGTCCCATGGACCCAGATCCTGG + Intergenic
938185257 2:129226089-129226111 TGTGCCAAGGAGGCACAGGCTGG + Intergenic
939694719 2:145310658-145310680 ATTCCCATGGACCCACTGGCTGG - Intergenic
941383296 2:164822380-164822402 GGGCCCTGGGAGCCCCAGGCAGG + Intronic
941494923 2:166188064-166188086 GGTCCCAAGGAGACAGAAGCAGG + Intergenic
941979038 2:171434563-171434585 GGGCCCATGGAGGCGCGGGCCGG - Exonic
948002856 2:234582409-234582431 GGTCCCATGAACACAGAGGCAGG - Intergenic
948436227 2:237956102-237956124 GGTCCCATGTAACCGCAGCCTGG + Intergenic
948551087 2:238773356-238773378 GGCCCCATGGAGAGACATGCAGG - Intergenic
948887078 2:240889784-240889806 GGTGCCGTGGTGCCGCAGGCTGG - Intronic
1168928060 20:1599007-1599029 GGTCCCAGGTAGCCTCAGGTGGG - Intronic
1169211876 20:3770338-3770360 GGCCCCCTGGAGACAGAGGCAGG + Intergenic
1169346149 20:4829456-4829478 GGTCCCCTGGACACACAGGAGGG + Intergenic
1170281104 20:14649848-14649870 GTTCTCATTGAGTCACAGGCTGG + Intronic
1171387423 20:24779750-24779772 GGTCCCATGGAGTCACAGAGTGG + Intergenic
1172217965 20:33249917-33249939 GGTCCCAGGTAGCCACAGGAGGG + Intergenic
1172271631 20:33658611-33658633 GTTCCCATGAGGCCCCAGGCCGG - Intronic
1172531781 20:35636035-35636057 CTTCCCATGGAGCCCTAGGCTGG - Intronic
1173595698 20:44257486-44257508 GGAGCCACAGAGCCACAGGCAGG + Intronic
1175818868 20:61897776-61897798 GGTTCCAGGGGGCCTCAGGCAGG + Intronic
1175931107 20:62494120-62494142 GGCCCCATGGAGACGCAGGCAGG - Intergenic
1176020097 20:62958463-62958485 GGTCCCCTGGAGAAACAGCCAGG + Intronic
1176021896 20:62966416-62966438 GGTCTCGTGGAGCCACGGGAGGG - Intronic
1177965589 21:27722536-27722558 GGTCCAAAGGAGACACAGGCAGG + Intergenic
1180590206 22:16930814-16930836 GGTCCCATGGTGGCTGAGGCTGG + Intergenic
1180855329 22:19041608-19041630 ATTCCCATTGAGCCACAGGGTGG - Intronic
1181534709 22:23535321-23535343 GCTAGAATGGAGCCACAGGCAGG + Intergenic
1182620960 22:31618289-31618311 GGGGCCATGGAGGGACAGGCAGG - Intronic
1183977975 22:41524094-41524116 TGACCCAGGGAGCCCCAGGCAGG - Intronic
1183980086 22:41534230-41534252 GCGCCCAGGGAGCCCCAGGCTGG + Intronic
1184105723 22:42366554-42366576 GGTCCAATGGAGCCAGGGGAGGG + Intergenic
1184425334 22:44405938-44405960 GGTCCCAGGGGGGCACAGGGAGG - Intergenic
1184786239 22:46673329-46673351 GCCCCCTTGGAGCCACAGCCTGG + Intronic
949409562 3:3749095-3749117 GGAGACATGAAGCCACAGGCAGG + Intronic
950581586 3:13865842-13865864 GGCCCCATGGAGCCTCATGATGG + Intronic
950882670 3:16335872-16335894 GGTCTCAGGAGGCCACAGGCAGG + Intronic
953278223 3:41525465-41525487 AGCCACAGGGAGCCACAGGCAGG + Intronic
954461495 3:50629494-50629516 GTTCCCAGGGAGCCACAAGGAGG - Intronic
961532205 3:127546830-127546852 GGTCCCGTGGAGACAGAGACTGG + Intergenic
962804343 3:138916083-138916105 GGTCCCAGGGATCCGCAGGGAGG + Intergenic
963060683 3:141222403-141222425 GGTTGAATTGAGCCACAGGCTGG - Intergenic
968085329 3:195871539-195871561 GGTCACAGGGGGCCACAGGGGGG + Intronic
968589143 4:1449086-1449108 GGTCCCCAGGAGCCCCAGCCAGG + Intergenic
968702844 4:2064879-2064901 GGTCCCATGGACCCCCACCCTGG - Exonic
969456236 4:7301303-7301325 ACTCTCATGGAGCCACAGCCTGG + Intronic
985032521 4:185804213-185804235 AGTCACATGGAACCACACGCAGG + Intronic
985627125 5:994939-994961 GTACCCACGGAGCCACTGGCAGG - Intergenic
985833238 5:2251491-2251513 CCTCTCATGGAGCCGCAGGCTGG + Intergenic
985963252 5:3319817-3319839 GCTCTCAAGGAGGCACAGGCTGG + Intergenic
987114486 5:14715106-14715128 GGAGCCATGGAGCCCCAGGTAGG - Intronic
988855960 5:35228687-35228709 GGTCCCCTGGAGTCAGAGGCTGG + Intronic
989134195 5:38136708-38136730 GGGGCCATGGAGGCAAAGGCAGG - Intergenic
992173558 5:74127527-74127549 AGTTCCAGGGAGGCACAGGCAGG + Intergenic
992204873 5:74421514-74421536 GGTCCCCTGGAGCCCTAAGCTGG + Intergenic
993525207 5:88956641-88956663 CTTTCCATGGAGCCACAGGATGG - Intergenic
993976687 5:94491489-94491511 GGTTCCATGGAGCCACAGCAGGG + Intronic
995320181 5:110825015-110825037 GGTCTCAGGGATCCAAAGGCAGG + Intergenic
996743812 5:126827880-126827902 GCTCCCATAGTGCCACGGGCAGG + Intronic
997389942 5:133506269-133506291 GATCCGTTGGAGCCAAAGGCAGG + Intronic
998168181 5:139856310-139856332 GGGTCCATGGTGCCACTGGCGGG - Intronic
998251867 5:140558732-140558754 GGTCCGCTTGAGCCGCAGGCGGG + Exonic
1000017098 5:157287705-157287727 AGGTCTATGGAGCCACAGGCAGG - Intronic
1000888283 5:166773505-166773527 GTTCCCATGGAGCTCCAGGAGGG + Intergenic
1002043391 5:176529709-176529731 GGTCCCATGGAGCCCCATGCTGG - Exonic
1002607350 5:180391011-180391033 AGTTCCACGAAGCCACAGGCGGG - Intergenic
1002888564 6:1316030-1316052 GGTCCCCTGGAACCAGAGGTGGG - Intergenic
1008543247 6:52564093-52564115 GGTCCCATGCACACACAGGATGG - Intronic
1008588471 6:52970219-52970241 GTTCCCAGGGAGCCAGAGCCTGG + Intergenic
1011845664 6:91560591-91560613 GGCCCGATCGAGCCACAGGTGGG + Intergenic
1015190220 6:130464185-130464207 GGTCCCCTGTAGCCAAAGGAAGG - Intergenic
1015827162 6:137326362-137326384 TCTCCCATGGAACCACAAGCTGG - Intergenic
1015886917 6:137927027-137927049 GGTCCAAATTAGCCACAGGCTGG + Intergenic
1016232913 6:141827941-141827963 GTTCCCATGGAGGGACAGGATGG - Intergenic
1016371118 6:143375386-143375408 GGTCACATGGAGCAAAAGGAAGG - Intergenic
1016847922 6:148587486-148587508 GGTCTCCAGGACCCACAGGCTGG + Intergenic
1016890719 6:149004494-149004516 GGGCCCATGGTGCCCCAGGAAGG + Intronic
1018804223 6:167246388-167246410 GGTTCCATGTAGCCACAGGTTGG + Intergenic
1018961105 6:168449108-168449130 GGACACAGGGAGCCACAGGCAGG - Intronic
1019331834 7:464132-464154 GGTTCCCCGGAGCCACAGGACGG + Intergenic
1019614378 7:1952523-1952545 GGGGCCAAGGAGCCACAGCCCGG - Intronic
1025192326 7:56905316-56905338 GATACCCTGAAGCCACAGGCAGG - Intergenic
1025679623 7:63671615-63671637 GATACCCTGAAGCCACAGGCAGG + Intergenic
1027184680 7:75963743-75963765 GTTCCAAGGGAGCCACATGCTGG + Intronic
1031831986 7:126639006-126639028 GGTCCACTGGAGCTACACGCTGG + Intronic
1034216883 7:149414735-149414757 GCGCCCCTGGAGCCACAGTCAGG - Intergenic
1034478352 7:151301691-151301713 GGTCCCATGGTTCCCCAGGCAGG + Intergenic
1034652097 7:152699782-152699804 GGTCCCATTGAGAAAGAGGCTGG - Intergenic
1037801912 8:22040573-22040595 GTTACCATGGAGACCCAGGCTGG + Intergenic
1039493306 8:37963947-37963969 GGTGCCGTGGAGCAGCAGGCTGG - Exonic
1039641181 8:39225056-39225078 TTTTCCATGGAGCCAGAGGCAGG - Intronic
1041100418 8:54391310-54391332 GGTCCCATAGAGCTACTGGGAGG + Intergenic
1041147625 8:54894495-54894517 GTTGACATTGAGCCACAGGCAGG + Intergenic
1044474455 8:92609677-92609699 GGTACAACGGAGCCAGAGGCTGG - Intergenic
1047306274 8:123655334-123655356 AGACCCATGGAGGCACAAGCAGG + Intergenic
1048381795 8:133871853-133871875 GGACCCATGGAGAGACTGGCAGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1048579977 8:135722771-135722793 AGACCCATGGAGGGACAGGCTGG + Intergenic
1049190458 8:141284741-141284763 GGACCCAGGCAGACACAGGCAGG - Intronic
1049224527 8:141443494-141443516 GGTCTCATGGACCCTCAGGCTGG - Intergenic
1049431485 8:142567292-142567314 GTTGGCATGGGGCCACAGGCTGG - Intergenic
1049662131 8:143824232-143824254 GGGCCCAGGGACGCACAGGCAGG + Intronic
1049798903 8:144508838-144508860 GGCCCCCTGGAGCCACAGAGCGG - Intergenic
1053426516 9:38013807-38013829 GGTCCCATGGAGCCACAGGCAGG - Intronic
1059141534 9:111857581-111857603 GATCCCAGGGAGCAAGAGGCAGG - Intergenic
1059365175 9:113781275-113781297 GGTCAAATGCAGCCACAGCCCGG - Intergenic
1059757926 9:117311041-117311063 GGTCCCAGGGAGCCCCAGTAGGG - Intronic
1061394108 9:130333923-130333945 GTCCCCTTGGAGCCACAGGCAGG + Intronic
1061401496 9:130370773-130370795 GAGCCCATGGCGCCACAGGCTGG - Intronic
1061609176 9:131735005-131735027 GCTCCCAGCGAACCACAGGCTGG - Intronic
1061613491 9:131763827-131763849 GGTGGAATGGAGCCCCAGGCCGG - Intergenic
1061882235 9:133574197-133574219 GGGGCCATGGAGCCCCAGTCAGG - Intronic
1062252022 9:135603052-135603074 GGACCCATGGAGTCAGCGGCAGG - Intergenic
1062254173 9:135613396-135613418 GGCCCCATGCAGCCCCAGGCAGG + Intergenic
1062282359 9:135757716-135757738 GGGGCCACGGGGCCACAGGCAGG + Intronic
1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG + Intronic
1203732023 Un_GL000216v2:99299-99321 GTTCCCAGGGAGCCCCAGCCCGG - Intergenic
1203654418 Un_KI270752v1:8981-9003 AGTCCTAGGGAGGCACAGGCAGG + Intergenic
1189249642 X:39590461-39590483 TTTCCCCAGGAGCCACAGGCAGG - Intergenic
1190640599 X:52480682-52480704 GGAACCTTGGAGCCAAAGGCAGG + Intergenic
1190647073 X:52532183-52532205 GGAACCTTGGAGCCAAAGGCAGG - Intergenic
1196734674 X:118973777-118973799 CGGCCCCTGGAGCCACTGGCCGG - Intergenic
1201062823 Y:10063110-10063132 GGGCCCATGTTGCCCCAGGCTGG - Intergenic