ID: 1053426691

View in Genome Browser
Species Human (GRCh38)
Location 9:38014778-38014800
Sequence CAGCAAAGGCAGAGCCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053426686_1053426691 11 Left 1053426686 9:38014744-38014766 CCTTCCATGAACAGGAGGAGCAG 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1053426691 9:38014778-38014800 CAGCAAAGGCAGAGCCTAGAAGG No data
1053426688_1053426691 7 Left 1053426688 9:38014748-38014770 CCATGAACAGGAGGAGCAGGAGG 0: 1
1: 0
2: 8
3: 53
4: 536
Right 1053426691 9:38014778-38014800 CAGCAAAGGCAGAGCCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053426691 Original CRISPR CAGCAAAGGCAGAGCCTAGA AGG Intronic
No off target data available for this crispr