ID: 1053427140

View in Genome Browser
Species Human (GRCh38)
Location 9:38017535-38017557
Sequence CTCTGTCCCTGGCAAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053427136_1053427140 2 Left 1053427136 9:38017510-38017532 CCCGGAAAGGGACAGCAGGCGGC 0: 1
1: 0
2: 0
3: 28
4: 209
Right 1053427140 9:38017535-38017557 CTCTGTCCCTGGCAAGTGGCTGG No data
1053427131_1053427140 16 Left 1053427131 9:38017496-38017518 CCAGGAATGTGATGCCCGGAAAG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1053427140 9:38017535-38017557 CTCTGTCCCTGGCAAGTGGCTGG No data
1053427128_1053427140 26 Left 1053427128 9:38017486-38017508 CCGCCAGCTGCCAGGAATGTGAT 0: 1
1: 1
2: 3
3: 25
4: 273
Right 1053427140 9:38017535-38017557 CTCTGTCCCTGGCAAGTGGCTGG No data
1053427137_1053427140 1 Left 1053427137 9:38017511-38017533 CCGGAAAGGGACAGCAGGCGGCA 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1053427140 9:38017535-38017557 CTCTGTCCCTGGCAAGTGGCTGG No data
1053427129_1053427140 23 Left 1053427129 9:38017489-38017511 CCAGCTGCCAGGAATGTGATGCC 0: 1
1: 0
2: 3
3: 93
4: 2841
Right 1053427140 9:38017535-38017557 CTCTGTCCCTGGCAAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053427140 Original CRISPR CTCTGTCCCTGGCAAGTGGC TGG Intronic
No off target data available for this crispr