ID: 1053427159

View in Genome Browser
Species Human (GRCh38)
Location 9:38017664-38017686
Sequence AGTGGTGGAGTAGCGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053427159_1053427170 17 Left 1053427159 9:38017664-38017686 CCCGCTGCCGCTACTCCACCACT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1053427170 9:38017704-38017726 TCAGGCTCTGAGTCCCAGTGGGG No data
1053427159_1053427164 -7 Left 1053427159 9:38017664-38017686 CCCGCTGCCGCTACTCCACCACT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1053427164 9:38017680-38017702 CACCACTTTCTCCGTGGCTGTGG No data
1053427159_1053427168 15 Left 1053427159 9:38017664-38017686 CCCGCTGCCGCTACTCCACCACT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1053427168 9:38017702-38017724 GCTCAGGCTCTGAGTCCCAGTGG No data
1053427159_1053427173 29 Left 1053427159 9:38017664-38017686 CCCGCTGCCGCTACTCCACCACT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1053427173 9:38017716-38017738 TCCCAGTGGGGACCCAGTAGGGG No data
1053427159_1053427171 27 Left 1053427159 9:38017664-38017686 CCCGCTGCCGCTACTCCACCACT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1053427171 9:38017714-38017736 AGTCCCAGTGGGGACCCAGTAGG No data
1053427159_1053427166 -1 Left 1053427159 9:38017664-38017686 CCCGCTGCCGCTACTCCACCACT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1053427166 9:38017686-38017708 TTTCTCCGTGGCTGTGGCTCAGG No data
1053427159_1053427169 16 Left 1053427159 9:38017664-38017686 CCCGCTGCCGCTACTCCACCACT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1053427169 9:38017703-38017725 CTCAGGCTCTGAGTCCCAGTGGG No data
1053427159_1053427172 28 Left 1053427159 9:38017664-38017686 CCCGCTGCCGCTACTCCACCACT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1053427172 9:38017715-38017737 GTCCCAGTGGGGACCCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053427159 Original CRISPR AGTGGTGGAGTAGCGGCAGC GGG (reversed) Intronic
902635337 1:17731400-17731422 GGTGGTGGGGTAGGGGCAGGGGG + Intergenic
902793151 1:18782860-18782882 AGGGGTGGAGGAGAGGGAGCCGG - Intergenic
903366801 1:22810345-22810367 AGTGGTGGGGTGGAGGGAGCTGG + Intronic
905236471 1:36553564-36553586 AGTAGGGGAGAAGCAGCAGCAGG - Intergenic
905651124 1:39657666-39657688 AGTGGTGAAGAAGGGGCCGCAGG + Intergenic
907842854 1:58173464-58173486 AGTGGTGGGGTCGCTGCTGCAGG - Intronic
909669183 1:78168903-78168925 AGTGGTGGAGCAGGGGCAGGAGG + Intergenic
911240866 1:95464523-95464545 AGTGGGGGCATGGCGGCAGCGGG - Intergenic
912488687 1:110049193-110049215 AGTGCTTGAGCAGCAGCAGCAGG - Exonic
916059946 1:161091508-161091530 AGGGGTGGAGTAGGGCCAGCGGG + Intergenic
916074704 1:161193662-161193684 AGTGTTGCAGGAGCGGAAGCGGG + Exonic
920070512 1:203299473-203299495 AGTGGTGGAGTGAAGGCTGCAGG - Intergenic
921389469 1:214604164-214604186 AGTGGTGGAGGTGGGGCAGGAGG + Intronic
1065514515 10:26511791-26511813 GATGGTGGATGAGCGGCAGCTGG + Exonic
1067330253 10:45309105-45309127 AGTGGGGGAGGAGGGACAGCAGG + Intronic
1068293272 10:55033252-55033274 ATTGATGGAGTTGTGGCAGCAGG + Intronic
1071366230 10:84903202-84903224 TGGGGTGGAGTGGAGGCAGCAGG + Intergenic
1072370895 10:94765637-94765659 AGTGGTGGGGGAGCTGCTGCAGG + Intronic
1072655441 10:97326924-97326946 ACTGGTGGAATAGAGGGAGCAGG + Intergenic
1075020558 10:118948976-118948998 AGGGGTGGAGCAGAGGCTGCAGG + Intergenic
1075587219 10:123666605-123666627 CGTCGTGGCGCAGCGGCAGCCGG + Exonic
1077015282 11:396534-396556 AGTGGTGGAGAGGAGGCAGGAGG + Intronic
1078556075 11:12327193-12327215 GGAGGTGGAGGAGCGGCAGAGGG + Exonic
1082954669 11:58857341-58857363 AGTGGGGAGCTAGCGGCAGCTGG + Intronic
1083369815 11:62169580-62169602 CGTGGTGCAGGAGCTGCAGCAGG + Intergenic
1083401546 11:62426609-62426631 AGTGGGGGAGGAGAGGGAGCTGG - Intergenic
1083429680 11:62607703-62607725 AGTGGTGGAGTAGGGGTTCCTGG - Exonic
1084033718 11:66495481-66495503 AGTGCTGGAGTAAGAGCAGCAGG + Exonic
1085282261 11:75339029-75339051 AGTGGTGGAGAGGAGGCAGCAGG - Intronic
1088789375 11:113211014-113211036 GGTGGTGGAGAAGAGGCACCAGG - Intronic
1089973871 11:122716017-122716039 AGTATTGGATTAGAGGCAGCAGG + Intronic
1090402841 11:126460090-126460112 AATGGAGGAGGAGCGGGAGCAGG + Intronic
1092387181 12:8044775-8044797 GATGGTGGAGCAGTGGCAGCAGG + Exonic
1093481808 12:19612104-19612126 AGTGGTGGATTAGCAGTAGGTGG + Intronic
1094183869 12:27620278-27620300 AGTGGTGGGGTAGTGGAATCTGG - Intronic
1096243703 12:49973014-49973036 CGTGGTGGAGGAGCTGCAGGTGG + Intronic
1098162289 12:67657267-67657289 AGTGGTGCCAGAGCGGCAGCTGG + Exonic
1102248511 12:111369917-111369939 GGTGGTGGAGAAGAGGCGGCAGG - Intergenic
1102419842 12:112794834-112794856 ACTGGGGGAGTAGGGGCTGCTGG - Intronic
1103228633 12:119309214-119309236 CCTGGTGGAGCAGCAGCAGCTGG + Intergenic
1104811299 12:131621883-131621905 AGTGCAGGAGCTGCGGCAGCAGG - Intergenic
1104963227 12:132497974-132497996 AGTGGTCGTGTGGCAGCAGCTGG + Intronic
1106763405 13:32890449-32890471 GGTGGTGGAGCAGTGGCTGCTGG + Intergenic
1108023552 13:46154605-46154627 ACTGGTGGAGTGGTAGCAGCTGG - Intronic
1110169680 13:72485598-72485620 AGTGGTGCAGTAGAGGAAGAGGG + Intergenic
1112102839 13:96209240-96209262 AGTTGTGGGTTAGCGGTAGCGGG + Intronic
1112116372 13:96359948-96359970 AGTGGTGGAATAGGGGTGGCTGG - Intronic
1112640038 13:101262779-101262801 AGTGGTGGAGTTACGGCTCCAGG - Intronic
1119318573 14:73715844-73715866 AGGGGTGGAGGCGCGGCAGAAGG + Exonic
1120243109 14:81973187-81973209 AATGGAGGTGTAGAGGCAGCAGG + Intergenic
1120742319 14:88121661-88121683 GGTGGTGGATTAGAGGCATCAGG - Intergenic
1120807909 14:88773139-88773161 ACTCGTGGAGTAGCTGCAGTGGG - Intronic
1125200756 15:37099082-37099104 AGCGGCGCAGCAGCGGCAGCAGG + Intronic
1125507263 15:40274048-40274070 AGTGGTGGAGGGGGGACAGCTGG - Intronic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1126907698 15:53385284-53385306 GGTGGTGGAGTACTGGCAGGTGG + Intergenic
1131367808 15:91854222-91854244 AGTGGTGCAGAGGCGGCCGCCGG + Intronic
1132144579 15:99421370-99421392 AGTGGAGGAGCAGAGGCAGTGGG - Intergenic
1135610132 16:23859239-23859261 ACTGGTGGAGTAGCTGAACCTGG - Intronic
1137574344 16:49588807-49588829 ACTGGTGGCGTAGTGGTAGCAGG - Intronic
1138106617 16:54290456-54290478 AATGGTGCAGCAGCGGCGGCGGG + Intergenic
1139972975 16:70787628-70787650 ACTGATGGAGGAGAGGCAGCTGG + Intronic
1140374512 16:74434093-74434115 ACTGGATGAGTAGCTGCAGCTGG - Intergenic
1140596876 16:76426128-76426150 ACTGGTGGAGTGGGGGCAGAAGG + Intronic
1141015172 16:80442033-80442055 AGTGGTGGTGCAGCTGCTGCAGG + Intergenic
1141125560 16:81398234-81398256 AGGGGTGGGTTAGCGGCACCAGG - Intergenic
1143289958 17:5820955-5820977 AGTGGGGGAGTGGGGGAAGCAGG + Intronic
1144584220 17:16478145-16478167 AGAGGTGGAGTGTGGGCAGCTGG - Intronic
1146401716 17:32504920-32504942 AGTGGAGAAGGAGCGGGAGCGGG - Intronic
1149991118 17:61384123-61384145 AGTGGTGGCGTGGCAGCACCTGG + Intronic
1151237850 17:72734516-72734538 TGGGGTGGAGTCGGGGCAGCAGG - Intronic
1152330802 17:79671485-79671507 AGTGGTGGAGCAGCGGCTCTGGG - Intergenic
1152537566 17:80959562-80959584 AGTGCTGGAGAAGCGGGGGCGGG - Intronic
1152589674 17:81205377-81205399 AGTGGGGTAGGAGGGGCAGCGGG + Intronic
1152750908 17:82062059-82062081 AGGGGTGGAGTAGGGGCAGAGGG - Intronic
1152819600 17:82430040-82430062 AGAGGAGGAGGAGCAGCAGCAGG - Intronic
1153831167 18:8924269-8924291 AGTGGTGGAATCGCGGCACACGG + Intergenic
1154445356 18:14431297-14431319 GGCGGCGGAGTAGCAGCAGCCGG - Intergenic
1156353746 18:36323172-36323194 AGAGGAGGAGCAGAGGCAGCCGG - Intronic
1156354781 18:36331756-36331778 AGGGGTGGGGGAGCTGCAGCTGG + Intronic
1159385580 18:67721367-67721389 TGTTGTGGGGTAGGGGCAGCGGG + Intergenic
1162740998 19:12773658-12773680 AGTGGAAGAGGAGAGGCAGCTGG - Intronic
1166863105 19:45821018-45821040 AGTGGTAGAGGCGCAGCAGCAGG - Intronic
1167467424 19:49657739-49657761 ACTGGTGGGGTGGCGACAGCGGG - Exonic
926166481 2:10524429-10524451 CATGGTGGAGGAGCAGCAGCTGG + Intergenic
926260629 2:11257161-11257183 AGTGGTGGAGGAGCAGGGGCTGG + Intronic
926304582 2:11628792-11628814 AGAGGAGGAGGAGAGGCAGCCGG + Intronic
926992910 2:18698852-18698874 AGTGGTGGAGCAGAGGAAACAGG + Intergenic
927729183 2:25455379-25455401 AGTGGTGGTGCAGCAGCAGTGGG - Intronic
928090617 2:28372134-28372156 TGTGGTGGGGTAGGGGGAGCGGG + Intergenic
929806994 2:45155017-45155039 AGTGGTGAGGAAGCAGCAGCTGG - Intergenic
929958820 2:46480686-46480708 GGTGATGGAGCAGCTGCAGCGGG + Exonic
931116936 2:59175084-59175106 TCTGGAGGAGCAGCGGCAGCGGG - Intergenic
931286933 2:60840132-60840154 AGTGGTGGAGTGGGGGCAGTGGG + Intergenic
932929076 2:76012433-76012455 TGTTGTGGAGTAGGGGGAGCGGG - Intergenic
937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG + Intergenic
938462806 2:131509031-131509053 GGTGGGGGAGTAGGGGGAGCAGG - Intergenic
939480839 2:142745254-142745276 GGTGGTGGAGTAGCTGAGGCAGG - Intergenic
940729635 2:157374399-157374421 TGTGGTGGGGTGGCGGGAGCGGG + Intergenic
940808378 2:158213980-158214002 AGTGGTGGGGTAGGGGGAGGGGG + Intronic
942829697 2:180225122-180225144 AGTGCTGGAGTTGAAGCAGCTGG - Intergenic
946305811 2:218856497-218856519 AGTGGTGGGGGAGAGGCAGCTGG - Intergenic
948541800 2:238696531-238696553 AGAGGTGGAGGAGCTGCAGGAGG + Intergenic
948754537 2:240151196-240151218 AGGGGTGAAGTGGCAGCAGCTGG - Intergenic
1168954480 20:1825281-1825303 AATGGTGGAGTAGCGGTGGCAGG - Intergenic
1169195797 20:3681515-3681537 AGGGGTGGAGGAGCAGGAGCGGG + Intronic
1170577919 20:17678609-17678631 AGTGCTGATGTAGAGGCAGCTGG - Intronic
1172192881 20:33072623-33072645 AGTGATGGAATAGGGTCAGCAGG + Intronic
1173471475 20:43326559-43326581 AGTGGGGGAGGAGTGGCTGCAGG - Intergenic
1173985667 20:47259627-47259649 AGGGGTGGAGTAGCCACACCAGG - Intronic
1175936584 20:62517029-62517051 AGTGGGGCAGTGGGGGCAGCAGG + Intergenic
1177644526 21:23884829-23884851 AGTTCTGGAGAAGCGACAGCTGG - Intergenic
1179612537 21:42561804-42561826 AGTGGCCGAGGAGCTGCAGCTGG + Intronic
1182204702 22:28611654-28611676 TGTGGTGGGGTAGGGGGAGCGGG - Intronic
1182573932 22:31260041-31260063 AGTGGTGGCGTAGTTGGAGCAGG - Exonic
1183386187 22:37516143-37516165 AGGGCTGGAGCAGCGGCTGCGGG - Exonic
1184520451 22:44990978-44991000 TGTGGAGGAGCCGCGGCAGCAGG - Intronic
1185171866 22:49299026-49299048 GGTGGTGGAGAAGCTGCTGCGGG - Intergenic
950210323 3:11118331-11118353 AGTGGTGGTGGAGCGGCTGAGGG - Intergenic
953260544 3:41334607-41334629 AGTGGAGGAGGAGACGCAGCAGG - Intronic
953517046 3:43603904-43603926 AGTGGTGGAGTAGGGGAAAGGGG + Intronic
954987855 3:54811417-54811439 ACTGGTGGTGTGGAGGCAGCAGG - Intronic
956668624 3:71664982-71665004 AGTTGTGGAGTAGTGGCTTCAGG - Intergenic
959439398 3:106358260-106358282 AATGGTGGAGTAGGGGAGGCAGG + Intergenic
960816591 3:121679784-121679806 AGTGGGGGAGGAGGGGCAGTCGG - Intronic
968063732 3:195746638-195746660 AGTGGAGCATTAGGGGCAGCTGG - Intergenic
968277811 3:197454297-197454319 AGGGGTGGAGTCGGGGGAGCAGG + Intergenic
968793971 4:2689803-2689825 AGAGGTGGTGGAGCAGCAGCTGG - Intronic
974944422 4:68509951-68509973 TGTGGTGGGGTAGGGGCAGGGGG - Intergenic
977518912 4:98056357-98056379 AGTGGTGGAGGCCTGGCAGCTGG - Intronic
982552402 4:156819180-156819202 ACTGATGGAGAAGCTGCAGCAGG + Intronic
984835808 4:184019795-184019817 AATGGGGGAGGAGTGGCAGCCGG + Exonic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
987744068 5:21947886-21947908 GGAGCTGGAGTAGCAGCAGCTGG - Intronic
991050556 5:62268358-62268380 AGTGGTGGAGCAACTTCAGCAGG - Intergenic
991764272 5:69958023-69958045 GGAGCTGGAGTAGCAGCAGCTGG - Intergenic
991783055 5:70160124-70160146 GGAGCTGGAGTAGCAGCAGCTGG + Intergenic
991843504 5:70833095-70833117 GGAGCTGGAGTAGCAGCAGCTGG - Intergenic
991875497 5:71160451-71160473 GGAGCTGGAGTAGCAGCAGCTGG + Intergenic
992380476 5:76231583-76231605 TGTGGTGGAGTGGGGGGAGCGGG - Intronic
994805781 5:104446522-104446544 TGTGGTGGGGTGGCGGGAGCGGG - Intergenic
999461255 5:151758993-151759015 AGCGGTGGAAGAGCAGCAGCAGG + Intronic
999702830 5:154244018-154244040 AGTGGGTGAGTAGCAGCACCAGG + Intronic
1001534244 5:172487661-172487683 TGTGGTGGGGGAGCGGGAGCAGG - Intergenic
1001929883 5:175665317-175665339 AGAGGGGGAGTAGAGGCAGCGGG + Intronic
1003187690 6:3847354-3847376 TGTGATGGAGAAGCTGCAGCAGG - Intergenic
1005583261 6:27252440-27252462 AGTGCTGGAAAAGCGACAGCTGG - Intronic
1005719541 6:28587506-28587528 AGTGCTGGAGTAGATGCTGCTGG + Intronic
1005916277 6:30354575-30354597 ATTGCTGGAGTAGAGGCACCTGG + Intergenic
1006736038 6:36273311-36273333 AGTGGGGGATTAGGGGCAGCCGG - Intronic
1007091459 6:39187449-39187471 AGTGGCGGAGGAGTGGCAGATGG - Intergenic
1011925724 6:92642985-92643007 AGTGGTAGAGTAGGGGCTACTGG - Intergenic
1015029775 6:128580666-128580688 CGTGGTGCAGGAGCTGCAGCAGG - Intergenic
1016950819 6:149577874-149577896 CGGGGTGTAGTAGCTGCAGCTGG - Intronic
1017853973 6:158332476-158332498 AGTGGTGGAGTGTGGGCAGAGGG + Intronic
1022514126 7:30964672-30964694 AGTGCTGGAGCAGAAGCAGCTGG - Intronic
1022800200 7:33769659-33769681 AGAGGTGGAGTAGTGGCTTCCGG + Intergenic
1023742832 7:43295634-43295656 AGTGGTGGAGGAGGGGCTGGTGG + Intronic
1023844790 7:44114499-44114521 AGTGTTGGAGTAGGGGCAGAGGG + Exonic
1023981091 7:45070444-45070466 AGTGGTGGAGCAGTGGCAGATGG + Intronic
1030809225 7:113955264-113955286 AGTGGTGGAGGCAAGGCAGCTGG + Intronic
1033452988 7:141478127-141478149 AGTGGTGGCGTGGAGGCAGTAGG + Exonic
1034104835 7:148481597-148481619 AGTTGTGGGGTGGCGGCAGGGGG - Intergenic
1034422226 7:150996038-150996060 AGAGGTGGGGTAGGGGCAGAGGG - Intronic
1034422252 7:150996104-150996126 AGGGGTGGGGTAGGGGCAGAGGG - Intronic
1036004726 8:4648790-4648812 AGTGGTGGGGTGGCATCAGCCGG - Intronic
1039896035 8:41717159-41717181 AGAGGTGGAGTTGCCCCAGCAGG + Intronic
1039965214 8:42279046-42279068 AGTGGTGGAGTAGAGGTGGAGGG + Intronic
1041100053 8:54387325-54387347 ACTGATGGAGAAGCTGCAGCAGG - Intergenic
1043501243 8:80859435-80859457 AGTGTTGGAGTAACAGCTGCAGG + Intronic
1046309616 8:112416967-112416989 TTTGGTGGAGTAAGGGCAGCAGG + Intronic
1047639160 8:126799762-126799784 TGTGGTGGGGTGGCGGCAGCGGG - Intergenic
1047951564 8:129939708-129939730 AGCGGGGGAGCGGCGGCAGCCGG + Exonic
1049257790 8:141623153-141623175 AGTGGGGCAGGAGCGCCAGCTGG - Intergenic
1049617269 8:143581134-143581156 AGTGGTACAGGAGCTGCAGCAGG - Exonic
1053097583 9:35341846-35341868 AGAGGAGGAGGAGCAGCAGCAGG + Intronic
1053427159 9:38017664-38017686 AGTGGTGGAGTAGCGGCAGCGGG - Intronic
1053453862 9:38215570-38215592 GGTGGTGGGGTAGGGGCAGGTGG - Intergenic
1056840733 9:89996397-89996419 AGTGGTGGAGCAGAGTCTGCTGG + Intergenic
1058662910 9:107283009-107283031 AGAGGCGGAGCCGCGGCAGCCGG + Intergenic
1060629656 9:125143843-125143865 AGAGGTGGAGGGGCGCCAGCAGG - Intergenic
1060665138 9:125428248-125428270 AGAGGTGGGGCCGCGGCAGCTGG + Intergenic
1061062491 9:128257651-128257673 AGTGCTGAAGGAGCGGCACCGGG - Exonic
1186452919 X:9688082-9688104 CGTGGTGCAGACGCGGCAGCAGG + Exonic
1187265228 X:17726054-17726076 AGTGGAGGAGAAGCTGCAGGAGG - Exonic
1187527017 X:20063473-20063495 ACTGGAAGAGCAGCGGCAGCGGG - Exonic
1188994169 X:36861900-36861922 AGTGGTGGAGAAGAGACAGGAGG + Intergenic
1190479305 X:50860021-50860043 AGTGGTGGGGTTGAGGGAGCGGG - Intergenic
1193884153 X:86963934-86963956 AGGGGTGGAGCAGCAGCATCTGG - Intergenic
1195869824 X:109474273-109474295 AGTGGTGGAGTGGCTGCAGTGGG + Intronic
1198705797 X:139446914-139446936 GGTGGTGGAGGAGCGCCTGCTGG + Intergenic
1199662213 X:150063365-150063387 TGTGGTGGAATGGAGGCAGCTGG + Intergenic
1200763874 Y:7063962-7063984 TGTGGTGCAGATGCGGCAGCAGG + Exonic