ID: 1053428853

View in Genome Browser
Species Human (GRCh38)
Location 9:38028527-38028549
Sequence GTTTGCACAAAGGAGGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053428853_1053428857 -9 Left 1053428853 9:38028527-38028549 CCAATCTCCTCCTTTGTGCAAAC 0: 1
1: 0
2: 1
3: 18
4: 242
Right 1053428857 9:38028541-38028563 TGTGCAAACAAATATGGCTCAGG No data
1053428853_1053428858 13 Left 1053428853 9:38028527-38028549 CCAATCTCCTCCTTTGTGCAAAC 0: 1
1: 0
2: 1
3: 18
4: 242
Right 1053428858 9:38028563-38028585 GCCACACCAGAATTGCGAAGAGG No data
1053428853_1053428861 29 Left 1053428853 9:38028527-38028549 CCAATCTCCTCCTTTGTGCAAAC 0: 1
1: 0
2: 1
3: 18
4: 242
Right 1053428861 9:38028579-38028601 GAAGAGGAACTCCAGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053428853 Original CRISPR GTTTGCACAAAGGAGGAGAT TGG (reversed) Intronic
901738184 1:11325470-11325492 GCTTGCGGAAAGGAGGTGATGGG + Intergenic
902784601 1:18724987-18725009 GCCTGCACAAAGTAGGTGATGGG + Intronic
903760221 1:25692578-25692600 CATTGCACAGATGAGGAGATTGG + Intronic
904699356 1:32349235-32349257 GTGGGCAGAAGGGAGGAGATGGG - Intergenic
904704472 1:32379545-32379567 GATTGGATAAGGGAGGAGATAGG - Intronic
904842042 1:33379218-33379240 GCTTGCCCACAGGAGGAGACAGG - Intronic
908663770 1:66466487-66466509 GTGTGCATAAAGGAGTAGAAAGG - Intergenic
909206413 1:72763404-72763426 CTATGGACAAATGAGGAGATTGG + Intergenic
909383907 1:75034741-75034763 GTTTGAACAGAGGAGAAGAGTGG + Intergenic
909909436 1:81243954-81243976 GTTTGAAAAAAGGAGGAGTATGG - Intergenic
911161802 1:94688877-94688899 GTTTGGCCAAGGGAGGAGACTGG - Intergenic
911204706 1:95080548-95080570 GTTTGAAAGAAGGAGGAGAATGG + Intergenic
912706809 1:111920777-111920799 GGTTACACAAAGGAAGAGGTTGG - Intronic
913395038 1:118359268-118359290 ATTTTCACAAAGTAGGAGAGAGG + Intergenic
915038265 1:152946828-152946850 GTTGGCAGAGAGGAGGGGATGGG - Intergenic
916385406 1:164262024-164262046 TTTTGCACAAAGGAAGAATTAGG - Intergenic
916428869 1:164708549-164708571 GTTTCCAAAAAGGAGGAGGGAGG - Intronic
916470317 1:165117332-165117354 GTGGGCACAGAGGAGGGGATTGG - Intergenic
916524327 1:165595176-165595198 GTTTCCAGACAGGAGGAGAATGG + Intergenic
917591863 1:176484164-176484186 CTATGCACATAGGAGGAGAACGG - Intronic
918105312 1:181411408-181411430 CAGTGCACAAAGGAGGAGAGAGG + Intergenic
918209900 1:182341249-182341271 CTTGGCACAAAGGAAGTGATAGG + Intergenic
919134598 1:193492023-193492045 GTTTTCACAAAGGAAGAGCAGGG - Intergenic
919174814 1:194005676-194005698 TATTTCACAAAGGAGGAAATAGG - Intergenic
919608665 1:199718147-199718169 GTTGGCACACAGCATGAGATAGG - Intergenic
919749815 1:201030553-201030575 GTTTGAACAAAGAAGAAGTTGGG - Intergenic
921700730 1:218265925-218265947 GTTTTCAAAGAGGAGAAGATTGG - Intergenic
923091583 1:230745125-230745147 GTTTGCACAATGAAGGACTTTGG - Intergenic
924177214 1:241403501-241403523 GACTGAAGAAAGGAGGAGATTGG - Intergenic
1063319142 10:5036329-5036351 GTTTGCACAAAAGGAGAGTTTGG - Intronic
1064923771 10:20547901-20547923 CATTGCCCTAAGGAGGAGATTGG + Intergenic
1065200481 10:23308377-23308399 GTTAGCCCGTAGGAGGAGATGGG - Intronic
1065538269 10:26735658-26735680 GATTGCATAAAGGAATAGATGGG + Intronic
1065853711 10:29813037-29813059 GACTGGACAAAGGAGGGGATGGG - Intergenic
1067659843 10:48226356-48226378 GTTTGGAAAAAAGAGGAGTTCGG - Intronic
1068520642 10:58073502-58073524 GGTTACACAAAGGCGGAGAGTGG - Intergenic
1069528133 10:69192335-69192357 GTTAGAACAAAAGAGGAGAGAGG - Intronic
1070011472 10:72479129-72479151 GTTTAAACAGAGGAGGATATTGG + Intronic
1070909622 10:80106464-80106486 GTTTGCACAAAAGGAGAGTTTGG - Intergenic
1075094117 10:119460020-119460042 CTTGGCACCAAGGAGGAGCTGGG + Intergenic
1075242321 10:120790437-120790459 TTTTTCAGCAAGGAGGAGATGGG - Intergenic
1077214973 11:1391408-1391430 GGCTGCACAGAGGAGGAGCTGGG + Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1079637159 11:22757971-22757993 GTTAACACAGAGGAGGAAATAGG - Intronic
1080011498 11:27464193-27464215 GTTTGCACACAGGAGAAGGCTGG + Intronic
1081066277 11:38544167-38544189 GTTTGCACACAGGAGGCGGGAGG - Intergenic
1081091873 11:38880296-38880318 GTTTGCACTAAGAAGTAAATTGG - Intergenic
1081435832 11:43026631-43026653 GTTTGCACAGGGGAAGAGTTTGG - Intergenic
1081508108 11:43739219-43739241 GCTTTCACAAAGGGGGAGTTCGG + Intronic
1081547348 11:44080936-44080958 GGTTGAACAAATGAAGAGATGGG - Intronic
1081779529 11:45700355-45700377 GTTTGCAGCAGGGAGGAGACTGG - Intergenic
1082851930 11:57773012-57773034 ACCTGAACAAAGGAGGAGATGGG - Intronic
1083057486 11:59836933-59836955 CTTTGCACATAGTAGGAGCTAGG + Intronic
1083063757 11:59901540-59901562 GTTTGGACAAAGAAGGAAAAGGG - Intergenic
1084074810 11:66765001-66765023 ATTAGCACTAGGGAGGAGATAGG + Intronic
1085266028 11:75238639-75238661 TTTTGCACAAATGGGGAAATAGG - Intergenic
1086167528 11:83797039-83797061 GTTCTCACAGAGGGGGAGATTGG + Intronic
1086591920 11:88524982-88525004 GTTTGCAAAGTGGAAGAGATTGG - Intronic
1088969330 11:114758496-114758518 GTTTGATCACAGGAGGAGACTGG + Intergenic
1089113687 11:116077121-116077143 GTAGGCAAAGAGGAGGAGATAGG + Intergenic
1089120144 11:116128165-116128187 GTTAGAACAATGGAAGAGATTGG + Intergenic
1089767313 11:120777357-120777379 GGTTTCACAAAGGAGGAGATGGG - Intronic
1090456034 11:126850504-126850526 GTTTGGATAGAGGAGGAGTTGGG - Intronic
1090972700 11:131656638-131656660 GTTTGGACAAAGGAGGAGGGCGG + Intronic
1091020172 11:132092456-132092478 GTTTGCAGAAGCAAGGAGATAGG - Intronic
1092547102 12:9461710-9461732 GCTTTCACAAAGGAAGAGACTGG + Intergenic
1093401333 12:18750413-18750435 GTTTTCACCTAGGAGGTGATTGG + Intergenic
1094505836 12:31060354-31060376 GCTTTCACAAAGGAAGAGACTGG - Intergenic
1096040166 12:48508273-48508295 GTTTGCACAAAAGGAGAGTTTGG - Intronic
1096201070 12:49683573-49683595 GTTTGCACAATGGAGATGATGGG - Intronic
1097586812 12:61525402-61525424 GTTTCCACAGAAGAGTAGATAGG - Intergenic
1101727392 12:107399398-107399420 GTTTGAACAATGGAGGGAATGGG - Intronic
1101803773 12:108045751-108045773 GTGTGCATGAAGGAGGAGAGAGG - Intergenic
1102384487 12:112496687-112496709 GGTTGAACAAATGAGTAGATAGG - Intronic
1104064099 12:125292543-125292565 GCTTGCACAAAGAAAGAGATTGG + Intronic
1107728085 13:43320047-43320069 GTTTGAACAAAAGACCAGATGGG + Intronic
1108037949 13:46311732-46311754 GTTTGCATCAGGGAGGAGCTTGG - Intergenic
1108703526 13:52964298-52964320 GGTTGCAAAAAGGAGGGGTTGGG + Intergenic
1110274941 13:73632672-73632694 GTTGCCAAAAAGGAGGAGGTGGG + Intergenic
1111633319 13:90871548-90871570 TTTTGCATACAGTAGGAGATAGG - Intergenic
1112333942 13:98498763-98498785 GTCTGCAGACAGGAGGACATGGG - Intronic
1113038788 13:106081618-106081640 CTTTCCACATATGAGGAGATAGG + Intergenic
1113602784 13:111582597-111582619 GGCTGCAGAAAGGATGAGATGGG - Intergenic
1114351452 14:21856324-21856346 GATTCCAAAAGGGAGGAGATGGG - Intergenic
1114956300 14:27823797-27823819 GTTTTCCCAAAGAAAGAGATGGG - Intergenic
1115370969 14:32614646-32614668 GTTAGGACAAAGGAGGAAAATGG - Intronic
1118511680 14:66481894-66481916 GTTTACACAAATAAGGAGATGGG + Intergenic
1119419366 14:74498622-74498644 GTTGGCAGGAAGGTGGAGATTGG + Exonic
1119693193 14:76692692-76692714 GTGAGCACAGAGGAAGAGATTGG - Intergenic
1119737887 14:76995553-76995575 GCTCACAGAAAGGAGGAGATTGG + Intergenic
1122425762 14:101604560-101604582 CTTTGCTCCAAGGAGGAGAAAGG - Intergenic
1123433329 15:20236713-20236735 GTAAGCATAAAGGAGGAGATTGG - Intergenic
1124000935 15:25759085-25759107 ATTTGGACAAAGGAGGGGAAGGG - Intronic
1126182742 15:45801781-45801803 GTTTTCATGAAGGAGGAGAATGG - Intergenic
1126773630 15:52081131-52081153 CTTTGCTCATAGGAAGAGATGGG + Intergenic
1127071275 15:55289998-55290020 GTTGGGACAAAGGAGGCGAGCGG - Intronic
1128130571 15:65224646-65224668 ATTTGCACAAAGCTGGTGATTGG - Intergenic
1128261324 15:66235031-66235053 CTCTGCACAAAGCAGGAGAGGGG + Intronic
1130564889 15:84985566-84985588 GTTTGCAAAAAGGAAGATAGGGG - Intronic
1131692989 15:94846376-94846398 GTTTGAATAATGTAGGAGATTGG - Intergenic
1134780280 16:16889165-16889187 GATTGGACAGAGGAGTAGATTGG + Intergenic
1137322638 16:47400789-47400811 GGGAGCACAAAGGAAGAGATGGG + Intronic
1140263362 16:73399546-73399568 GTTTTCACAAAGGTGCAAATGGG + Intergenic
1140375960 16:74445796-74445818 GTTGGCTCAAATGAGGAGGTAGG - Intergenic
1141539620 16:84709677-84709699 GTTTCAAAAAAGGAGGAGAGTGG + Intronic
1142814585 17:2415202-2415224 TTGTGCACATAGGAGGAGAAGGG - Intronic
1144478712 17:15611576-15611598 GGTGACACAAAGGAGGAGACGGG - Intronic
1144919589 17:18752155-18752177 GGTGACACAAAGGAGGAGACGGG + Intronic
1145373138 17:22323669-22323691 GTGGACACAAAGGATGAGATTGG - Intergenic
1149423395 17:56532032-56532054 GTGTGCACACAGGTGGATATGGG - Intergenic
1151588161 17:75024127-75024149 GTTTGCACAAAAGGAGAGTTCGG - Intergenic
1155549863 18:26953516-26953538 GGTTGCACAAAGTAAGTGATGGG + Intronic
1157390164 18:47295157-47295179 GTGTGCAGAAAGAGGGAGATGGG - Intergenic
1159025650 18:63180388-63180410 CGTTTCACAAAGGAGGAGAAGGG - Intronic
1159309856 18:66692615-66692637 ATTTCCACATAGGAGGAAATAGG + Intergenic
1159578173 18:70205463-70205485 GTTTACACAAAGTCCGAGATGGG + Intronic
1159977125 18:74727833-74727855 TTTTGCACAGAGGAGTAGAGTGG + Intronic
1160567530 18:79796608-79796630 GTCTGCAAAAGGGAGGTGATGGG + Intergenic
1161156765 19:2735868-2735890 GTGTCCAGAAAGGAGGAGAAGGG - Intronic
1162144887 19:8607524-8607546 TTTTGCACAGAGGAGGAGGAGGG - Intronic
1163959542 19:20675764-20675786 TTTTGGACAAGGGAGGAGAAGGG - Intronic
1167223199 19:48217192-48217214 GGTTGCACAGAGGAGGTGAGTGG - Intronic
1167658345 19:50780835-50780857 GTTTGCACACAAGTAGAGATGGG - Intergenic
1168440024 19:56356695-56356717 AATTGCACAAAGAAGGATATGGG - Intronic
929176791 2:38986105-38986127 TTTTGCCCAAAGGGGGAGGTTGG + Exonic
929541297 2:42824519-42824541 ATCTGCAAAACGGAGGAGATGGG + Intergenic
930723437 2:54659498-54659520 GTGTGCACACAGGATGAGAAAGG - Intronic
935722410 2:105991111-105991133 GTTTGCACAAAAGGAGAGTTTGG - Intergenic
936133947 2:109873054-109873076 TTTTTCAGAAAAGAGGAGATAGG - Intergenic
936210750 2:110498431-110498453 TTTTTCAGAAAAGAGGAGATAGG + Intergenic
938182063 2:129192394-129192416 TTTTGCAGAGAGGAGGACATAGG + Intergenic
938705100 2:133916880-133916902 GTTTGCAGCAAGGAGGAGCCTGG + Intergenic
939137248 2:138312267-138312289 GTTTGCAAAAAGAAGGGGCTGGG + Intergenic
939837505 2:147149222-147149244 GTTAACACAAGGGAGGAGAATGG + Intergenic
940410269 2:153354719-153354741 GTTTACACACAGGAGTAGAATGG - Intergenic
941394057 2:164952432-164952454 TTTTGCAGAAAGTAGTAGATGGG - Intronic
943237243 2:185338078-185338100 GCTTGAGCAAAGGAGAAGATAGG - Intergenic
944376846 2:199055410-199055432 GTTAACACAAATGAGGAAATAGG - Intergenic
946539029 2:220663367-220663389 GTTTACACAAAGGAGTTAATGGG + Intergenic
946931043 2:224671595-224671617 GTATGAAGAAAGGAAGAGATTGG - Intergenic
947625270 2:231614750-231614772 GTTTTCACCAAGGGGCAGATGGG + Intergenic
948720538 2:239897461-239897483 GTTTAGACACAGGAGTAGATTGG + Intronic
1169968453 20:11243136-11243158 GTTTCCCCAAGGGAGTAGATTGG - Intergenic
1170948059 20:20909813-20909835 GTTTGCAGCAGGGAGGAGCTGGG - Intergenic
1173096358 20:40032879-40032901 TTTTTCACAAAGGAGCAGTTAGG + Intergenic
1173326392 20:42037454-42037476 GTTTGCACAGAGCAGGAAAGGGG - Intergenic
1173467061 20:43291542-43291564 CCTTGCTCAAAGGAGTAGATGGG + Intergenic
1174087966 20:48023127-48023149 ATTTAGACAAAGCAGGAGATAGG + Intergenic
1182080816 22:27527324-27527346 GGTTGCACAAAGTAGGTGATTGG - Intergenic
1182366271 22:29781463-29781485 TTTAGAACAAAGGAGGTGATAGG + Intergenic
1182423454 22:30259699-30259721 GTTTGCAAGCAGGAGAAGATAGG + Intergenic
1182947876 22:34341933-34341955 ACTTGCACAAAGGAAGTGATAGG - Intergenic
1184920136 22:47600382-47600404 GTTTGCACAGAGGCTGAGAGGGG - Intergenic
950492502 3:13314569-13314591 CCTTGCCCAAAGAAGGAGATGGG + Intergenic
950715454 3:14844527-14844549 GTTTGTGCAAAGGAAGGGATAGG + Intronic
951380565 3:21979181-21979203 ATTTGTAAAAAGGAGGATATGGG + Intronic
953183761 3:40619860-40619882 GTGTGGACAAAGGAGGAGGTGGG - Intergenic
955753897 3:62208704-62208726 GTTTGCCCAAAGGAGCAGAGTGG - Intronic
955980225 3:64517854-64517876 GTTATCAGAAAGGAGGAGATGGG - Intronic
957967133 3:87336909-87336931 GTTTTCAAAGAGGAGGACATGGG - Intergenic
959228318 3:103615229-103615251 TTTGGCACAAAAGAGGAAATTGG - Intergenic
963037488 3:141045130-141045152 GTTTAGACACAGGATGAGATAGG - Intergenic
964254694 3:154762640-154762662 GTTATCACAAATGAGGAGAATGG + Intergenic
964327388 3:155562124-155562146 GTATGCAGACAGGAGCAGATTGG - Intronic
965027651 3:163324165-163324187 GTTTGCAGTAAGGAGGAGCCTGG + Intergenic
965028193 3:163329096-163329118 GGTTTCACACAGGAGGAGAAAGG - Intergenic
967521341 3:190436313-190436335 TTGAGCACAAAGGAGAAGATGGG - Intronic
968236239 3:197031365-197031387 GTTTGCACAAAGGTGCCGAATGG + Intergenic
968890877 4:3367783-3367805 GCTCCCACAAAAGAGGAGATGGG + Intronic
972697085 4:41458228-41458250 ATGTGCAAAAAGAAGGAGATTGG - Intronic
975493974 4:75017715-75017737 GTTTGCAAATAGGAAGATATGGG + Intronic
975645891 4:76545555-76545577 ATTTGCTGAGAGGAGGAGATAGG - Intronic
978305994 4:107329311-107329333 GTTTGCACAAAAGAAGAGTTTGG - Intergenic
979358243 4:119730954-119730976 ATCTGCACAAAGGAGGACCTTGG + Intergenic
980561910 4:134488867-134488889 GTGTGGACAATGGAGGAGAATGG - Intergenic
981681166 4:147399908-147399930 ATTTGCATAAAGGAGGACACTGG + Intergenic
982446314 4:155494911-155494933 TTTGGCACAAAGGGGAAGATGGG + Intergenic
984432506 4:179666434-179666456 GTTTCCACACAGGAGGAGGAGGG - Intergenic
985175191 4:187192968-187192990 GTCTGCCCAAAGGAAGAAATAGG + Intergenic
986320157 5:6624445-6624467 GTTTGGAAGATGGAGGAGATGGG - Intronic
986960995 5:13212615-13212637 GTTACCATAAAGGCGGAGATGGG - Intergenic
987523878 5:19023035-19023057 GTTAGCACAATGAAGGAAATAGG + Intergenic
987923449 5:24312126-24312148 GTTTGCACAAAAGGAGAGTTCGG + Intergenic
989188018 5:38643474-38643496 GTTTGCAGGAAGGAGGAGCCTGG - Intergenic
990275888 5:54195965-54195987 GGTAGCACACAGGAGAAGATGGG - Intronic
991455301 5:66797142-66797164 ATTTTAACAAAGGAGGAAATAGG - Intronic
992413279 5:76528530-76528552 CTTTGAAAAAAGGAGAAGATTGG - Intronic
994287580 5:97988574-97988596 CTTTGTAAAAAGGAGGAAATTGG + Intergenic
995948173 5:117675958-117675980 GTTTTCACAGAGAAGAAGATAGG - Intergenic
997497951 5:134346309-134346331 GTTTGCTGAAAGGAGTGGATAGG - Intronic
997904320 5:137800052-137800074 GTTCTTACAGAGGAGGAGATTGG + Intergenic
998388049 5:141769512-141769534 CTCTGCAGAAAGGAGGAGAGAGG - Intergenic
998962872 5:147507771-147507793 GTTTGCAAAAGGGAGGAAAACGG + Intronic
999067171 5:148700145-148700167 AATTGCAGAAAGGAGGAAATGGG + Intergenic
999217172 5:149944957-149944979 GTCTGCACAGAGCAGGAGGTGGG + Intergenic
999622877 5:153490410-153490432 GTGTGCAGAAAGGTGGAGGTGGG - Intronic
1003768264 6:9266283-9266305 GTTTGTACCAAAAAGGAGATGGG - Intergenic
1006705239 6:36014536-36014558 TTCTGCAGAAAGGAAGAGATGGG + Intronic
1006902433 6:37511861-37511883 CTTGGCACACAGGAGGAGATGGG - Intergenic
1007161430 6:39794329-39794351 GTTTGCATAAAGGAAGAAATGGG - Intronic
1007752437 6:44078530-44078552 GATTGCTCAGAGGAGGACATGGG + Intergenic
1008127622 6:47686680-47686702 GTTTGCACTTAGCAGGAGGTGGG - Intronic
1009242251 6:61197239-61197261 GTAAGGAAAAAGGAGGAGATGGG + Intergenic
1010685930 6:78855397-78855419 GTTTGCACAAAAGGAGAGTTTGG - Intergenic
1011692625 6:89884192-89884214 TTCTGTACAAAGGATGAGATAGG + Intergenic
1012108435 6:95196422-95196444 GTTTGGGCAAAGGAAGAGAGAGG - Intergenic
1012612154 6:101230157-101230179 GTTTTTCCAAATGAGGAGATTGG + Intergenic
1013058943 6:106612894-106612916 GTTTGGACAAGGGAGGGGAAGGG - Intronic
1017988010 6:159461409-159461431 GTTTACAGAGAGGAGGGGATGGG - Intergenic
1018466458 6:164050952-164050974 GTTTCCACAAAGGAGAAGAGGGG - Intergenic
1018739042 6:166713281-166713303 GTTTTCACACCGGAGGAGGTGGG + Intronic
1020481147 7:8663196-8663218 ACTTGCAAAAAGAAGGAGATTGG + Intronic
1020937182 7:14481747-14481769 GTTTGCACACAGGGAGAGATTGG - Intronic
1021020799 7:15596141-15596163 GTTGGCACAAAGGTTGAAATTGG - Intergenic
1021150573 7:17146033-17146055 TTTTGCACAATGCAGGAGTTGGG + Intergenic
1021152808 7:17172862-17172884 GTTACCACAAAGAAGGAGGTGGG - Intergenic
1023170856 7:37389050-37389072 GTTTGCTCAAAGGAGGAAACCGG - Intronic
1023492937 7:40763629-40763651 GGTTGCACAGAGAATGAGATTGG + Intronic
1024882099 7:54098765-54098787 GTTTGGAAAAGCGAGGAGATCGG + Intergenic
1025724259 7:64043221-64043243 ATGTGCACAAAGCAGGAGTTGGG + Intronic
1027171023 7:75872535-75872557 GCTTGGAAAAAGGAAGAGATGGG - Intronic
1027808234 7:82857815-82857837 CTTTTGACAAAGGAGGAGAGAGG + Intronic
1028746334 7:94331052-94331074 GCTTGTACATAGGAAGAGATAGG - Intergenic
1029046918 7:97639710-97639732 GTTTCCACACAGGAAGAGAAGGG + Intergenic
1030562971 7:111114435-111114457 GTTTGCACAAAGAAATATATTGG + Intronic
1032075597 7:128834354-128834376 GATTCCTCAAAGGAGGTGATGGG + Intronic
1032519985 7:132536549-132536571 GTTTGCTCAGAGGAGAAGCTTGG - Intronic
1033277516 7:139983880-139983902 GTTTGCACAGAGAAGTGGATTGG + Intronic
1033288019 7:140059166-140059188 GTATTTACCAAGGAGGAGATGGG + Intronic
1035238128 7:157513431-157513453 GTTCACAGAAAGGAGGAGAGGGG - Intergenic
1035323119 7:158046983-158047005 GTTTACACAAGGGAGGCGAGCGG + Intronic
1038433038 8:27515100-27515122 GTTTCCACACAGGAGGAGGAGGG - Intronic
1041057814 8:54005787-54005809 ATTTGCACATTGGAGGAAATGGG - Intronic
1041763974 8:61398025-61398047 TTTTGCACAAAAAAGGAGCTTGG + Intronic
1042217356 8:66439459-66439481 GTTTCCAAAAAGGAGGACGTGGG + Intronic
1047750130 8:127874303-127874325 GGCTGCACAGAGGAGGAGAAGGG + Intergenic
1049534674 8:143173174-143173196 CTTTGCAGAAGGGAGGAGATGGG - Intergenic
1050781416 9:9341408-9341430 GGGTTCACAAAGGAGGAGATGGG - Intronic
1052556835 9:30029421-30029443 GTTTGAAAACAGGAGAAGATGGG + Intergenic
1052691829 9:31825121-31825143 GTTTGCACTTAAGAGGTGATAGG + Intergenic
1052786739 9:32835308-32835330 TGTTGCAGGAAGGAGGAGATGGG + Intergenic
1053428853 9:38028527-38028549 GTTTGCACAAAGGAGGAGATTGG - Intronic
1053594232 9:39543788-39543810 GTTTCCACACAGGAAGAGGTGGG - Intergenic
1053852013 9:42298834-42298856 GTTTCCACACAGGAAGAGGTGGG - Intergenic
1054572021 9:66821169-66821191 GTTTCCACACAGGAAGAGGTGGG + Intergenic
1055671950 9:78616461-78616483 CTTTGCGCAAAGGAGGACTTGGG + Intergenic
1058585989 9:106506608-106506630 CATTTCACAAAGGAGGATATGGG - Intergenic
1060976661 9:127768914-127768936 GTTTGAACAAAGGAGACGAAGGG - Intronic
1186813571 X:13213681-13213703 GTTTGAGCAAAGAAGGAGAAGGG + Intergenic
1189634236 X:42987923-42987945 TGGTACACAAAGGAGGAGATGGG + Intergenic
1189990040 X:46585631-46585653 TTTTGCAAAAAGGAGATGATTGG + Intronic
1192146124 X:68684203-68684225 GTTAGCAAAGAGGAGGAGAGGGG - Intronic
1192783878 X:74319450-74319472 GTTTTCTCAAAAGAGCAGATGGG - Intergenic
1192804738 X:74498814-74498836 GTTTTCTCAAAAGAGCAGATGGG + Intronic
1194066259 X:89266295-89266317 GTTTCCACACAGGAAGAGAAGGG + Intergenic
1194704073 X:97153065-97153087 TTTTGTACAAATGAGGAAATAGG - Intronic
1195060380 X:101188642-101188664 GTTTGCACAAAAGAAGAGTTCGG + Intergenic
1195595989 X:106690443-106690465 GTATGCACAAACAAGGAGAAAGG - Intergenic
1195785634 X:108518559-108518581 GGTTGCAGAAAGGAGGTGAGAGG - Intronic
1196217741 X:113073088-113073110 TTTTGCACAAGGTAGAAGATGGG + Intergenic
1196514412 X:116552682-116552704 GTATGGATAAAGGAGGAGAAGGG - Intergenic
1200720430 Y:6600414-6600436 GTTTCCACACAGGAAGAGAAGGG + Intergenic