ID: 1053428961

View in Genome Browser
Species Human (GRCh38)
Location 9:38029189-38029211
Sequence AGCCCCAGCCTGGCATAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053428950_1053428961 23 Left 1053428950 9:38029143-38029165 CCAGGCCCAAAGCTTTCAACACC 0: 1
1: 0
2: 2
3: 17
4: 180
Right 1053428961 9:38029189-38029211 AGCCCCAGCCTGGCATAAAGGGG No data
1053428949_1053428961 26 Left 1053428949 9:38029140-38029162 CCACCAGGCCCAAAGCTTTCAAC 0: 1
1: 0
2: 0
3: 6
4: 145
Right 1053428961 9:38029189-38029211 AGCCCCAGCCTGGCATAAAGGGG No data
1053428955_1053428961 -7 Left 1053428955 9:38029173-38029195 CCAATCAACTCTGCCCAGCCCCA 0: 1
1: 0
2: 5
3: 32
4: 360
Right 1053428961 9:38029189-38029211 AGCCCCAGCCTGGCATAAAGGGG No data
1053428952_1053428961 17 Left 1053428952 9:38029149-38029171 CCAAAGCTTTCAACACCAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1053428961 9:38029189-38029211 AGCCCCAGCCTGGCATAAAGGGG No data
1053428951_1053428961 18 Left 1053428951 9:38029148-38029170 CCCAAAGCTTTCAACACCAAGTG 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1053428961 9:38029189-38029211 AGCCCCAGCCTGGCATAAAGGGG No data
1053428954_1053428961 2 Left 1053428954 9:38029164-38029186 CCAAGTGGTCCAATCAACTCTGC 0: 1
1: 0
2: 0
3: 6
4: 142
Right 1053428961 9:38029189-38029211 AGCCCCAGCCTGGCATAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053428961 Original CRISPR AGCCCCAGCCTGGCATAAAG GGG Intronic
No off target data available for this crispr