ID: 1053429104

View in Genome Browser
Species Human (GRCh38)
Location 9:38030242-38030264
Sequence TGTACATGGTCCAGGACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053429104 Original CRISPR TGTACATGGTCCAGGACTAA TGG (reversed) Intronic
900739639 1:4322877-4322899 TGGACATGGTTGAGGAATAACGG + Intergenic
901250397 1:7773428-7773450 TTTACATGTTCCAGGTCTACAGG + Exonic
912852608 1:113140178-113140200 AATAAATGGTCCAGGATTAATGG + Intergenic
915068649 1:153246959-153246981 TGGAAGGGGTCCAGGACTAAGGG + Intergenic
916471224 1:165124817-165124839 TCCACATGGTCCAGTACGAAAGG + Intergenic
922251370 1:223851775-223851797 TATGGATGGGCCAGGACTAAAGG + Intergenic
923074316 1:230596082-230596104 TGTACAAGGTACATGACTCAAGG + Intergenic
923501853 1:234571565-234571587 TTTACATGGGCCAGGCATAATGG + Intergenic
924816614 1:247447505-247447527 TATAAATGGTGCAGGACAAATGG + Intronic
1077726452 11:4679695-4679717 TGTGCATAGGCCAGGGCTAAGGG - Intergenic
1088736795 11:112734400-112734422 TGTCCATGGTCCTGGACTCAGGG + Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1098446835 12:70574781-70574803 TGGACTTGGTACACGACTAATGG - Intronic
1101789198 12:107912410-107912432 TGGAGTTGGTCCAGGACCAAGGG + Intergenic
1105346772 13:19580364-19580386 TGTAATTGGTACAGTACTAAAGG + Intergenic
1105614951 13:22003215-22003237 TGTGCATCGTCCAGCTCTAAAGG + Intergenic
1110481672 13:75985011-75985033 TGAACATGGGGCAGGAATAATGG + Intergenic
1112252519 13:97795254-97795276 TACACATGGTCCATGACTTATGG - Intergenic
1116890685 14:50265143-50265165 TATAAATGGACCAGCACTAAGGG + Intronic
1129207905 15:74048169-74048191 TGGACATGGGCCAGGACAAGGGG - Intergenic
1135067788 16:19325097-19325119 TGGAAATGGTCCAGGAGTGATGG + Intergenic
1136750993 16:32635739-32635761 TGAACATGGTCCAGGTCAACAGG - Intergenic
1139596811 16:67963040-67963062 TGCAAATGGACCAGGACTCAGGG + Intronic
1141578260 16:84979551-84979573 TGTACATGATCCAGCTCTACTGG - Intronic
1203053127 16_KI270728v1_random:894995-895017 TGAACATGGTCCAGGTCAACAGG - Intergenic
1144063397 17:11602946-11602968 TGTGCATGGTCCAGGGCCAATGG - Intronic
1148136269 17:45293928-45293950 TGTACTAAGTCCAGGACTACTGG + Intronic
1153418595 18:4878922-4878944 TCTAGATGGACAAGGACTAATGG + Intergenic
1153661426 18:7329495-7329517 TGCAAATGGCCCAGGACTCAAGG + Intergenic
1155811408 18:30240332-30240354 TGTTCATTATCCATGACTAATGG + Intergenic
1158272405 18:55730900-55730922 TGTACATGTTCCAGAAATTAAGG - Intergenic
1166418784 19:42617455-42617477 TGTACAGGGTTCATGACTTATGG + Intronic
927150935 2:20195598-20195620 TGTACACAGTGCAGGACTGAAGG - Intergenic
933307319 2:80618591-80618613 TGTACATGGTCCTCTACTAAGGG - Intronic
933617521 2:84497997-84498019 TGTACATGGCCCAGAGCTCATGG - Intergenic
935456583 2:103276080-103276102 GGTTCATGGTCCAAGAATAATGG + Intergenic
935654625 2:105411516-105411538 TGTAAATGGTCCTGAACTTAGGG + Intronic
935785336 2:106543753-106543775 TCTCCATGGTCCAGGGCTACTGG - Intergenic
942263479 2:174195888-174195910 TGAACATGTTTCGGGACTAATGG - Intronic
942474457 2:176302761-176302783 TGTTCATGGCCCAGCATTAATGG - Intronic
944209852 2:197195669-197195691 TGGAAATGTTCCAGAACTAAAGG - Intronic
944664147 2:201945681-201945703 TTCACATGTTCCAGGACTAGAGG + Intergenic
1173499051 20:43539259-43539281 TGTCCATGGTCCAGGAGCATTGG - Intronic
1179049901 21:37880277-37880299 TGTGCATTGTCCAGGAAAAAAGG + Intronic
1179968923 21:44823470-44823492 TGTACATGGTGCAAGAGAAAAGG - Intergenic
1183639864 22:39086355-39086377 TGGACCTGGACCAGGACTACAGG + Exonic
951364362 3:21762771-21762793 TGGATATGGTCCACGACCAAGGG - Intronic
954092306 3:48294902-48294924 TTTACATGCCCCAGGACTGAAGG - Intronic
959940699 3:112077802-112077824 TTTTCATGGTCCAGGATTCAAGG + Intronic
963400674 3:144793492-144793514 TGTACATGGTTTAACACTAAAGG - Intergenic
963655417 3:148042637-148042659 TGTAAAGAGTCCAGCACTAATGG - Intergenic
967722554 3:192830725-192830747 TGTTCATGGCCCAGGAGCAAAGG + Intronic
971870715 4:32234929-32234951 TCTACATGATCCAGTACAAAAGG + Intergenic
977995984 4:103497720-103497742 TGCACAGGGTCAAGGACTGAAGG + Intergenic
982467518 4:155748809-155748831 TGTCCATGGTCCAGGAAGTAAGG - Intergenic
987667369 5:20960917-20960939 TGCAGCTGGGCCAGGACTAAGGG + Intergenic
995629883 5:114121447-114121469 TATACATGGCTCAGGTCTAAGGG - Intergenic
1000660137 5:163928074-163928096 TGAACATCGTCCAGGACAGAAGG + Intergenic
1001211687 5:169815757-169815779 TGTGCAGGGGCCAGGACTAGGGG - Intronic
1001992548 5:176129992-176130014 TGAACATGGTCCAGGTCAACAGG - Intronic
1002002269 5:176203409-176203431 TGAACATGGTCCAGGTCAACAGG - Intergenic
1005852869 6:29835253-29835275 TGAAAATGCCCCAGGACTAAAGG + Intergenic
1011538304 6:88402342-88402364 TGTACATGGTTGAGGAGGAATGG - Intergenic
1012289888 6:97440217-97440239 TTTAGATGGTCCACAACTAAAGG + Intergenic
1012847381 6:104407746-104407768 TTTATATGGTCAAGGACTCAAGG + Intergenic
1013926733 6:115481538-115481560 TGAAAATAATCCAGGACTAAAGG - Intergenic
1014364896 6:120527258-120527280 TGTATATCTTCCAGGAATAAGGG - Intergenic
1016312351 6:142747539-142747561 TGTACATGGTCCAGGGATCCAGG - Intergenic
1019176787 6:170163588-170163610 TGTACATGCTTCAGGAGTCAGGG - Intergenic
1021247178 7:18277954-18277976 TAGACATGGTAAAGGACTAACGG - Intronic
1027630250 7:80595216-80595238 TGTACACTGCCCAGTACTAAAGG + Intronic
1041288827 8:56288698-56288720 TGTCCATGCACCAGTACTAATGG - Intergenic
1043213485 8:77553946-77553968 TCTAGAAGGTCCAGGACAAAGGG + Intergenic
1046340222 8:112844689-112844711 TGTATCTGGTCCAAGACTAATGG - Intronic
1047259077 8:123240280-123240302 TCTACATGATCCAGGGCTGAAGG + Intronic
1050029953 9:1375414-1375436 TTTCCATGGGTCAGGACTAAAGG - Intergenic
1051049465 9:12914140-12914162 TGTCCAGGTTCCAGGACTATAGG + Intergenic
1051639177 9:19208611-19208633 TGAACATGTACCTGGACTAATGG + Intergenic
1053429104 9:38030242-38030264 TGTACATGGTCCAGGACTAATGG - Intronic
1056667898 9:88596609-88596631 TCTTCATGGTCCAGGACACATGG - Intergenic
1062133396 9:134912412-134912434 TGCAGATGGCCCAGGCCTAAGGG + Intronic
1062694377 9:137865821-137865843 TCTTCATGGTCCAGGACACACGG - Intronic
1186212827 X:7268297-7268319 AGTACATAGACCAGGACAAAAGG - Intronic
1187522168 X:20023364-20023386 AGAAGCTGGTCCAGGACTAAGGG + Intronic
1189857372 X:45236911-45236933 AGTTCATGGACCATGACTAATGG - Intergenic
1200408653 Y:2840298-2840320 TGTACATGGTGCAGGACATTGGG - Intergenic