ID: 1053429800

View in Genome Browser
Species Human (GRCh38)
Location 9:38034594-38034616
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053429800 Original CRISPR CAGGATGCAGGCGTGTTCTG TGG (reversed) Intronic
901002392 1:6155183-6155205 CAGGAAGCTGGGGTGTTTTGGGG - Intronic
901608411 1:10477032-10477054 CAGGCTGCCAGCATGTTCTGTGG - Intronic
902152860 1:14459126-14459148 CAGGAAGCCTGCGTGTTCAGTGG - Intergenic
913090816 1:115475432-115475454 CAGCCTGCAGGTGTTTTCTGAGG - Intergenic
913107237 1:115625648-115625670 CAGGAAACAAGCTTGTTCTGTGG - Intergenic
913538267 1:119795045-119795067 CAGGCTGCTGGCCTGTCCTGCGG + Intronic
917711179 1:177687145-177687167 CAGGCTGCCGGCTTGTTCTGAGG + Intergenic
918136427 1:181678058-181678080 TAGCTTGCAGGCCTGTTCTGTGG + Intronic
918400045 1:184154047-184154069 CAGGATCCAGGCTTGTGCAGAGG - Intergenic
919182361 1:194103211-194103233 CAGAAGGCAGGTGTTTTCTGTGG - Intergenic
920066248 1:203272102-203272124 CAGGCTCCAGGCGTCTTCTTAGG - Intronic
920300971 1:204988745-204988767 CAGGACGCAGGTGGGCTCTGGGG + Exonic
923855366 1:237839519-237839541 CAGGGTGCTAGCGGGTTCTGGGG - Intergenic
1062944290 10:1448958-1448980 CAGGCTGCATGTGTGTCCTGTGG - Intronic
1063227937 10:4033825-4033847 CAGGAGGCAGATGTGTGCTGAGG + Intergenic
1064269857 10:13854860-13854882 AAGGCTGCAGGCATGCTCTGGGG + Intronic
1070731067 10:78828576-78828598 CAGGAAGCAGACTTGTGCTGCGG + Intergenic
1071006519 10:80889884-80889906 CAGGATGCAGACATGTTCAGAGG + Intergenic
1075926715 10:126257039-126257061 CAGGATGCAGAAGTGGACTGGGG - Intronic
1076550253 10:131273376-131273398 CAGGAGGCAGGCGAGTGCTTTGG - Intronic
1083308733 11:61773853-61773875 GAGGATGCAGGGGTGTGGTGTGG + Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1084392199 11:68884745-68884767 CAAGAGGCAGGCATGATCTGGGG + Intergenic
1084531542 11:69730669-69730691 AAGTGTGGAGGCGTGTTCTGGGG + Intergenic
1084600575 11:70143075-70143097 CAGGATGCACCCCTGCTCTGTGG + Intronic
1084671232 11:70607708-70607730 CAGGATGGTGGCATGTCCTGGGG - Intronic
1084762832 11:71284784-71284806 TAGGATGCTGGGATGTTCTGTGG + Intergenic
1089067939 11:115676256-115676278 CAGGATGCAAGAGGGTTCTGGGG - Intergenic
1089359895 11:117878704-117878726 CAGCACGCAAGCTTGTTCTGGGG + Intergenic
1089879704 11:121762069-121762091 CAGGCTGCAGGGGAGCTCTGTGG + Intergenic
1090730983 11:129573350-129573372 CAGGCTGCAGCCGTGATCTCTGG - Intergenic
1091533232 12:1380332-1380354 GAGGATGCATGCGCTTTCTGTGG - Intronic
1093112731 12:15171120-15171142 CAGGATGCACCCATGTGCTGAGG + Intronic
1096053456 12:48631301-48631323 TAGGTTGCAGGCATTTTCTGAGG - Intergenic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1098247228 12:68532825-68532847 GAGGCTGCAAGCCTGTTCTGAGG + Intergenic
1102832618 12:116019196-116019218 TAGGATCCAGGAGTGTCCTGGGG - Intronic
1103568392 12:121828672-121828694 CAGGAGGCAGGCATGTTCCGGGG + Intronic
1104354279 12:128071505-128071527 CTGGATGCGGGAGTGTCCTGAGG + Intergenic
1104597942 12:130132687-130132709 CAGGAGGCAGGCACGATCTGCGG + Intergenic
1104902967 12:132199063-132199085 CAGCCTGCTGGGGTGTTCTGAGG - Intronic
1104953525 12:132453142-132453164 CAGGATGTTGGCTTGCTCTGTGG - Intergenic
1104978236 12:132561584-132561606 CAGGAAGGAGGCGGGTGCTGAGG - Intronic
1106561655 13:30851948-30851970 CAGGACTCAGGCTTGGTCTGGGG - Intergenic
1107811247 13:44201789-44201811 CATGTTACAGGAGTGTTCTGAGG - Intergenic
1108211026 13:48139897-48139919 CAGGATGCAGGGGAGCTCTGGGG - Intergenic
1115642076 14:35341398-35341420 CAGCATGCAGGTGTGGGCTGAGG - Intergenic
1117374430 14:55107957-55107979 GAGGCTGCAGGCGTGAGCTGGGG + Intergenic
1120840579 14:89081692-89081714 CGGCGTGCAGGCCTGTTCTGAGG - Intergenic
1122273877 14:100581247-100581269 ATGGTTGCAGGAGTGTTCTGGGG + Intronic
1122318500 14:100839609-100839631 AAGGAGGCAAGCCTGTTCTGTGG - Intergenic
1122413212 14:101536425-101536447 CAGGATCCAGGCAAGTGCTGGGG + Intergenic
1122552709 14:102558680-102558702 CAGGCAGCAGGCATGTTCTGTGG + Intergenic
1123104162 14:105830190-105830212 CAGGCTCCAGGCTTGTACTGGGG + Intergenic
1125746272 15:41999773-41999795 CAGGATGGAGGAGTCTTGTGGGG - Intronic
1128237968 15:66080367-66080389 CAGGAGCCAGGTGTGTGCTGCGG - Intronic
1129009595 15:72403177-72403199 CAGAAAGCAGTAGTGTTCTGTGG - Intronic
1130430615 15:83843347-83843369 CAGGATGCTGGCATGTTATCAGG + Intronic
1132699398 16:1215929-1215951 CAGGATGCAGGCGTCGGCTGCGG + Intronic
1132807492 16:1781922-1781944 GAGGATGCAGGCGGGTGCGGCGG - Intronic
1135141872 16:19928915-19928937 CAGGATACAGGGGTTTTGTGAGG + Intergenic
1135874837 16:26188935-26188957 GAGGCTGCAGGTGTCTTCTGAGG - Intergenic
1136750079 16:32627380-32627402 CAGGATGCAGGCAAGTACTATGG + Intergenic
1138280670 16:55770322-55770344 CAGGATGAAGAGGTGTTCTTCGG - Intergenic
1138287816 16:55823301-55823323 CAGGATGAAGAGGTGTTCTTCGG + Intronic
1138444518 16:57055072-57055094 GAGGAGGAAGGCGTGTGCTGTGG + Exonic
1203052207 16_KI270728v1_random:886579-886601 CAGGATGCAGGCAAGTACTATGG + Intergenic
1142957676 17:3532478-3532500 CCGGAGGCAGGTTTGTTCTGAGG - Intronic
1144522915 17:15966317-15966339 CAGGTTGGAGGCGGGTTCTGGGG + Intronic
1144722484 17:17481114-17481136 CAGAGTGCAGGTGTCTTCTGAGG + Intronic
1145209914 17:21005179-21005201 CAGGACCCAGGTGTGCTCTGAGG - Intronic
1145247906 17:21281847-21281869 CAGGATGCAAGCATGATCTGAGG - Intergenic
1147535640 17:41320784-41320806 CATGATGCAGGCATCTTCTCAGG + Intergenic
1148855914 17:50579283-50579305 GAGGAAGCAGGCTTGTTTTGTGG + Intronic
1149289132 17:55198407-55198429 CAGGATGCATGAGTGGGCTGTGG + Intergenic
1151537092 17:74745167-74745189 CAGAATGCAGGTGTGTCCAGGGG - Intronic
1151910457 17:77079473-77079495 CATGATGCAGGTGGGCTCTGGGG + Intergenic
1153451289 18:5232502-5232524 CAGGATCCAGGCTAGTACTGGGG + Intergenic
1157590506 18:48833720-48833742 AAGCATGCAGGTGTTTTCTGGGG - Intronic
1161280137 19:3441560-3441582 CAGGGGCCAGGCCTGTTCTGAGG - Intronic
1162550253 19:11354769-11354791 CAGGATCTGGGCCTGTTCTGAGG - Intronic
1164617359 19:29675054-29675076 CAGGGTGCAGGTGGGTTCTGTGG - Exonic
1164862769 19:31575693-31575715 CAGGAGGCAGGAGTATTTTGTGG + Intergenic
1166812859 19:45524567-45524589 CAGGATGAAGTCGTCTTCTTCGG + Exonic
925372398 2:3356200-3356222 CTGGATGCAGGCTTTTCCTGAGG + Intronic
927429749 2:23017419-23017441 CAGGGTGCAGGCGTGTGGGGCGG - Intergenic
928021399 2:27707942-27707964 CAGGTTCCAGGCCAGTTCTGGGG - Exonic
929084896 2:38158459-38158481 CAGGATGCTGGGGAGTTCAGGGG + Intergenic
929961145 2:46497314-46497336 AAGGATTGAGGCGTGTGCTGAGG + Intronic
936242787 2:110802291-110802313 CAGCTTCCAGGTGTGTTCTGGGG + Intronic
937649722 2:124306652-124306674 GACCATGCAGGTGTGTTCTGGGG - Intronic
940219406 2:151336025-151336047 CAGGTTGCAGGAGTGGTGTGGGG - Intergenic
940425512 2:153526417-153526439 CAAGATGCAGGTGAGTTCTATGG - Intergenic
941648201 2:168064748-168064770 CAGAATGCAGGCCTGTGCTCTGG + Intronic
944546309 2:200802459-200802481 CAGGATGAAGTCTTATTCTGTGG + Intergenic
947201540 2:227618782-227618804 CACACTGCAGGCTTGTTCTGAGG - Intronic
947704096 2:232260475-232260497 CAGGAAGCATGTGTGTGCTGTGG - Intronic
947923981 2:233904942-233904964 TAGGATGCAGACGTCTTTTGGGG + Intergenic
948187803 2:236035033-236035055 CAGGCTGCAGGCGCATTGTGAGG + Intronic
948884325 2:240875333-240875355 CCTGATGCAGGCGGATTCTGGGG - Intronic
948923855 2:241081618-241081640 CATGAGGCAGGCCTGTCCTGGGG + Intronic
1169054870 20:2612274-2612296 CAGGGTGCAGGGGTGGTCGGGGG - Exonic
1169117433 20:3074888-3074910 GGGGATGGGGGCGTGTTCTGGGG - Intergenic
1174501015 20:50984359-50984381 CAGGAAGAAGGCGTGTGTTGTGG + Intergenic
1175196113 20:57244485-57244507 CAGGATGCAGGAGAGAACTGGGG + Intronic
1180121082 21:45748615-45748637 GTGGATGCAGCCGTGTTCAGAGG - Intronic
1181669476 22:24419479-24419501 CAGGAAGCAGGTGTGCCCTGAGG + Intronic
1182318221 22:29461931-29461953 CAGGAAGCAGGCTGGTGCTGAGG + Intergenic
1183485334 22:38085150-38085172 CAGGCTGCCGGGGTGGTCTGGGG + Exonic
1184096588 22:42319460-42319482 CAGGAGGCAGGGGAGGTCTGGGG - Intronic
1184702588 22:46186450-46186472 AAGGATGAAGGCGTGGGCTGGGG + Intronic
1185177304 22:49335192-49335214 CAGGATGCAGGAGTGAGGTGTGG + Intergenic
1185260831 22:49861947-49861969 CAGGGTGCAGGCCTGTGCGGGGG - Intronic
949514722 3:4796643-4796665 CAGCATTCAGGCCAGTTCTGGGG + Intronic
951587874 3:24233806-24233828 CAGAGTGCAGGCATGTTCAGTGG + Intronic
954655920 3:52194280-52194302 CTGGATGCAGGCATGGCCTGGGG - Intergenic
958451652 3:94280740-94280762 CAAGATGCAGTCTTGCTCTGTGG + Intergenic
960710856 3:120526664-120526686 CAGGATGCAGGCTTTCTCTGTGG - Intergenic
961391210 3:126553240-126553262 CAGGATGCTGGGGTGACCTGGGG + Intronic
962274567 3:134002282-134002304 CAGGAGGCAGGAGGGTGCTGAGG - Intronic
962358285 3:134713641-134713663 CTGGGTGCAGGCTTGGTCTGGGG + Intronic
962597207 3:136958362-136958384 CAGAATGCAGGCCTTTTCTTTGG - Intronic
968930976 4:3578622-3578644 AAGGATGTGGGCGTGTTATGGGG - Intronic
972339156 4:38136048-38136070 CAGGATGCAGCTGTGAGCTGGGG + Intronic
976343169 4:83967184-83967206 GATGATGCAGACTTGTTCTGTGG + Intergenic
977667040 4:99653900-99653922 GAGGAGGCAGGATTGTTCTGGGG + Exonic
984784512 4:183555069-183555091 CAGGGTGCGGGCGGGTACTGTGG - Intergenic
985030967 4:185789047-185789069 CAGAGCGCAGGTGTGTTCTGCGG - Intronic
988423676 5:31037525-31037547 AAGGATGCAGGCATGTTGGGAGG + Intergenic
993317676 5:86431566-86431588 AAGGAAGCAGGAGTGTTTTGAGG + Intergenic
993494803 5:88596123-88596145 CAGGGTGTAGGTGTATTCTGTGG + Intergenic
998230798 5:140360472-140360494 TTGGATGCAGGCCAGTTCTGTGG + Intronic
1000456807 5:161459649-161459671 CAGGATGCAGGCGAATCATGCGG + Exonic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003065280 6:2899789-2899811 CATGATGAAGGCGTGTCCAGCGG + Intronic
1008231277 6:48987157-48987179 CAGGCTCCAGGCTTGTACTGGGG - Intergenic
1019170067 6:170128869-170128891 CAGGAAGCAGGCGGGTTGGGGGG + Intergenic
1019186701 6:170224699-170224721 CAGGAGGCAGGGGTGGTCAGTGG - Intergenic
1019669826 7:2271443-2271465 CCGGATGCAGGTGTGGGCTGTGG + Intronic
1020360534 7:7322533-7322555 CAGCTTGCAGGCATGCTCTGTGG + Intergenic
1025241745 7:57282379-57282401 CAGGCTGCTGGCCTGTCCTGTGG + Intergenic
1026166518 7:67914933-67914955 CAGGCTGCTGGCCTGTCCTGTGG + Intergenic
1031090539 7:117348548-117348570 CAGTAAGGAGGTGTGTTCTGGGG + Intergenic
1034107465 7:148502493-148502515 CAGGATTCATGCTTGTTTTGAGG + Intergenic
1034432734 7:151049241-151049263 CAGGAAGGCGGCGTGCTCTGCGG - Exonic
1034634053 7:152553512-152553534 CTGGGTGCAGGAGTGGTCTGTGG + Intergenic
1035331933 7:158102116-158102138 CAGGGTGAAGGCGTGGGCTGAGG - Intronic
1035474974 7:159136884-159136906 CAGGAAGCAGCCAGGTTCTGAGG + Intronic
1036678681 8:10854764-10854786 CAGGAGTCACGCGTGTTCTCAGG + Intergenic
1038132309 8:24746106-24746128 CAGGATGAAGGGGAGATCTGGGG - Intergenic
1039256439 8:35724066-35724088 CAGGATGCCAGCGTGTTCCGTGG + Intronic
1039646447 8:39289812-39289834 AGGGCTGCAGGTGTGTTCTGAGG + Intergenic
1040522406 8:48189435-48189457 CAGGGTGCTGGGGTGCTCTGTGG + Intergenic
1041512873 8:58670974-58670996 CAGGAGGCAGGCCTGGGCTGGGG - Intergenic
1046893515 8:119448882-119448904 CAGGAAGCAGGCATGTCATGAGG + Intergenic
1048605498 8:135964182-135964204 CAGGATAGAGGGGTGTCCTGTGG - Intergenic
1048908740 8:139113962-139113984 CAGGGTGGAGTCGTCTTCTGTGG + Intergenic
1049361716 8:142215237-142215259 CAGGATCCAGCTGTGTTCGGAGG + Intronic
1049530690 8:143153354-143153376 CAGGCTGCAGGCGTGGCCTCCGG - Intergenic
1051437241 9:17045769-17045791 CAGGATGCAGGGGTGGGGTGGGG + Intergenic
1053429800 9:38034594-38034616 CAGGATGCAGGCGTGTTCTGTGG - Intronic
1053429900 9:38035158-38035180 CAGGATGCAGGCGTGTTCTGTGG + Intronic
1056902589 9:90613576-90613598 CAGGATGAAGGCGTGCCCTTTGG + Exonic
1059471561 9:114508578-114508600 CAGGTTGCAGTTGTCTTCTGGGG - Intergenic
1060497210 9:124127434-124127456 GAGGATGCAGTTCTGTTCTGTGG - Intergenic
1060889173 9:127177396-127177418 CAGCATGCAGGCGTGTTGAATGG - Intronic
1062018936 9:134307170-134307192 GGGGAGGCAGGCGTGTTGTGAGG + Intergenic
1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG + Intergenic
1062723027 9:138054252-138054274 CAGGAACCAGGCATGTTCTGAGG + Intronic
1186784996 X:12948998-12949020 TAGGATGCAGACATGTTTTGGGG - Intergenic
1190947846 X:55113320-55113342 CAGGCTGCAGGTATGTTGTGGGG - Intronic
1192021954 X:67403242-67403264 CAGGCTCCAGGCCAGTTCTGGGG + Intergenic
1192085253 X:68089716-68089738 TAGGATGCAGTTGTGATCTGAGG - Intronic
1192845482 X:74902824-74902846 CAGCATGCAGGCAAGTTCTCTGG + Intronic
1195707677 X:107749912-107749934 GAGGATGTAGGCCTGTTGTGGGG - Intronic
1198506793 X:137309128-137309150 CTGGCTGCAGGCCTGTTCTCGGG + Intergenic
1200236179 X:154468813-154468835 CTGGCTGCAGGAGTGTGCTGGGG + Exonic
1201941092 Y:19460922-19460944 CAGGATGAAGGCCAGATCTGGGG + Intergenic