ID: 1053433997

View in Genome Browser
Species Human (GRCh38)
Location 9:38063223-38063245
Sequence GAGTGTGGCTGTTCATCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053433991_1053433997 15 Left 1053433991 9:38063185-38063207 CCCTGACCTTTGCCATTAGTGAT 0: 1
1: 0
2: 2
3: 12
4: 144
Right 1053433997 9:38063223-38063245 GAGTGTGGCTGTTCATCAAATGG No data
1053433993_1053433997 9 Left 1053433993 9:38063191-38063213 CCTTTGCCATTAGTGATATTTTA 0: 1
1: 0
2: 0
3: 27
4: 309
Right 1053433997 9:38063223-38063245 GAGTGTGGCTGTTCATCAAATGG No data
1053433994_1053433997 3 Left 1053433994 9:38063197-38063219 CCATTAGTGATATTTTAAGAACT 0: 1
1: 0
2: 2
3: 29
4: 354
Right 1053433997 9:38063223-38063245 GAGTGTGGCTGTTCATCAAATGG No data
1053433992_1053433997 14 Left 1053433992 9:38063186-38063208 CCTGACCTTTGCCATTAGTGATA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1053433997 9:38063223-38063245 GAGTGTGGCTGTTCATCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053433997 Original CRISPR GAGTGTGGCTGTTCATCAAA TGG Intronic
No off target data available for this crispr