ID: 1053434636

View in Genome Browser
Species Human (GRCh38)
Location 9:38067155-38067177
Sequence CCCATAAGGTCCCAGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 222}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053434636_1053434645 -6 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434645 9:38067172-38067194 TATGGGGTAGGGGTGAGGTCAGG No data
1053434636_1053434652 20 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434652 9:38067198-38067220 GAAGCAGGTGAGGATAGGAGGGG No data
1053434636_1053434650 18 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434650 9:38067196-38067218 AGGAAGCAGGTGAGGATAGGAGG No data
1053434636_1053434648 10 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434648 9:38067188-38067210 GGTCAGGAAGGAAGCAGGTGAGG No data
1053434636_1053434655 25 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434655 9:38067203-38067225 AGGTGAGGATAGGAGGGGTGGGG No data
1053434636_1053434653 23 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434653 9:38067201-38067223 GCAGGTGAGGATAGGAGGGGTGG No data
1053434636_1053434649 15 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434649 9:38067193-38067215 GGAAGGAAGCAGGTGAGGATAGG No data
1053434636_1053434654 24 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434654 9:38067202-38067224 CAGGTGAGGATAGGAGGGGTGGG No data
1053434636_1053434651 19 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434651 9:38067197-38067219 GGAAGCAGGTGAGGATAGGAGGG No data
1053434636_1053434647 5 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434647 9:38067183-38067205 GGTGAGGTCAGGAAGGAAGCAGG No data
1053434636_1053434646 -2 Left 1053434636 9:38067155-38067177 CCGTGTTCCTGGGACCTTATGGG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1053434646 9:38067176-38067198 GGGTAGGGGTGAGGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053434636 Original CRISPR CCCATAAGGTCCCAGGAACA CGG (reversed) Intronic
900312113 1:2038695-2038717 CTCAGAAGGTCCCAGGGACTTGG - Intergenic
900924998 1:5699387-5699409 CCCATCAGGAGACAGGAACATGG + Intergenic
901079583 1:6576349-6576371 CCCACATGGTCCCAGAAGCAAGG - Intronic
901180497 1:7338214-7338236 CCCGTTAGGTCCCAGAAAGAAGG + Intronic
901729256 1:11267008-11267030 CCCATAAGATCTCAGGAGCTGGG - Intergenic
901938503 1:12644528-12644550 TCCTCAAGGCCCCAGGAACATGG + Exonic
902134752 1:14295355-14295377 CCCATGAGCTGCCAGAAACATGG + Intergenic
903216408 1:21845946-21845968 CCCACACGGTCCCAGGACCAAGG - Intronic
904294294 1:29507759-29507781 CCCACAAGGACCCAAGAACAGGG - Intergenic
906456960 1:46005475-46005497 CCCATTCAGTCCCAGGATCAGGG - Intronic
907308445 1:53526296-53526318 CTCATGAGGTCCCAGGGCCATGG - Intronic
907320640 1:53600046-53600068 CCCAGGAGGCCCCAGGACCATGG - Intronic
909713105 1:78674291-78674313 CCTATAAGATCTCAGGAACTGGG - Intergenic
910461612 1:87453761-87453783 CCTATAAAGTCCTAGGATCAAGG - Intergenic
915642410 1:157239026-157239048 CCTATAAAGTCCCAGGATCAAGG - Intergenic
916706529 1:167356785-167356807 CCTATAAAGTCCCAGGATCAAGG - Intronic
917766991 1:178231053-178231075 CCGATAAGATCTCAGGAACTGGG - Intronic
918623705 1:186634073-186634095 CCCAGAAGCTACCAGGAACCAGG - Intergenic
921063466 1:211606259-211606281 CCCCTGTGGACCCAGGAACAGGG - Intergenic
922399015 1:225232616-225232638 ACCATAAGGTCAAAGGATCATGG - Intronic
923151891 1:231241095-231241117 CCCACAATGTCGCAGGAGCAAGG - Exonic
923511933 1:234660347-234660369 CCTATGAAGTCCCAGGATCAAGG + Intergenic
1063824432 10:9878299-9878321 CCTATAAAGTCTCAGGAGCAAGG + Intergenic
1065741205 10:28798740-28798762 CCCATGATGTCCCAGGATGAGGG - Intergenic
1065828982 10:29597317-29597339 CCTATAAAGTCCCAGGATCAAGG + Intronic
1066978024 10:42387141-42387163 CCCATATGCTCCCAGTAAAAAGG - Intergenic
1068056720 10:52020606-52020628 CCCATAAAGTCCTAGGATCAAGG - Intronic
1069118305 10:64535906-64535928 CCTATGAAGTCCCAGGATCAAGG - Intergenic
1073532275 10:104243675-104243697 CCTATAAAGTCCTAGGATCAAGG - Intronic
1074002622 10:109387886-109387908 CCTATAAAGTCCCAGGATCAAGG + Intergenic
1075412955 10:122242406-122242428 TCCACAAGGACCCAGGGACAAGG + Intronic
1078473620 11:11611711-11611733 CCCAAAATGTCCCAGGCACCGGG - Intronic
1078904539 11:15671696-15671718 CCCAGAAGGTCCCAGGACCTAGG - Intergenic
1079820305 11:25118766-25118788 GACATAAGGTCCCTGGAAGATGG - Intergenic
1083423452 11:62569767-62569789 CCCATGAGGCCCCTGGCACAGGG + Intronic
1083998702 11:66284546-66284568 CCCATCAGGCCCCAGGAACAAGG + Intronic
1084981347 11:72830362-72830384 AGCACAAGGTCCCAGGGACATGG - Intronic
1085053436 11:73391184-73391206 CCCAGAGGTGCCCAGGAACATGG - Exonic
1085490794 11:76915264-76915286 CCCATAAAGTCCTAGGATCAAGG - Intronic
1086259720 11:84924369-84924391 CCCATCAGCTTCCAGCAACAAGG + Intronic
1086791801 11:91048836-91048858 CCTATAAAGTCCCAGGATCATGG + Intergenic
1087302687 11:96454483-96454505 CCCACCAGGTCCCTGGCACATGG + Intronic
1087438874 11:98157986-98158008 CCTATAAAGTCCTAGGATCAAGG - Intergenic
1089490382 11:118879768-118879790 CCCATGATGTGCCAGGCACAAGG + Intergenic
1089677441 11:120099253-120099275 TCCAGAAGGTTCCAGGATCATGG + Intergenic
1090048895 11:123359946-123359968 CCCAAAAGTTCCCAGGAGAAGGG - Intergenic
1090350331 11:126103926-126103948 ACCATAAGTCCACAGGAACAAGG - Intergenic
1091757925 12:3067350-3067372 CCTATAAAGTCCTAGGATCAAGG + Intergenic
1096878686 12:54649704-54649726 TCACCAAGGTCCCAGGAACAGGG - Intergenic
1097461781 12:59871740-59871762 CCCATGATGTCCCAGGACCCAGG + Intergenic
1097492120 12:60283059-60283081 CCCACCAGCTCCCTGGAACATGG + Intergenic
1098584718 12:72142216-72142238 CCTGTAAAGTCCCAGGATCAAGG + Intronic
1099205562 12:79722190-79722212 CACAGAGGGTCCCAGGATCAGGG - Intergenic
1101599841 12:106199697-106199719 CCCATAAGGTCCAGGGAAACGGG + Intergenic
1101961140 12:109251156-109251178 CCCATAAGATCTCAGGAGCTGGG - Intronic
1103126733 12:118429828-118429850 CCTATAAAGTCCTAGGATCAAGG - Intergenic
1107799805 13:44095134-44095156 CCTATAAAGTCCTAGGATCATGG - Intergenic
1109959563 13:69613064-69613086 CCTATAAAGTCCTAGGATCAAGG - Intergenic
1110982591 13:81919870-81919892 CCGATAAGATCCCAGGAATTGGG - Intergenic
1113960122 13:114121512-114121534 CCCAAACGGTCCCAGGGTCATGG + Intronic
1114791110 14:25659463-25659485 CCCATGTGGTCCCAGGGTCAGGG + Intergenic
1115675250 14:35666343-35666365 CCCTTAATGTCTCAGGTACATGG + Intronic
1116443284 14:44979365-44979387 CCCATAAGGACACAGCAAGAAGG - Intronic
1116628982 14:47304898-47304920 CCAAGAAGGTATCAGGAACATGG - Intronic
1122281230 14:100623595-100623617 CATATAAGTTCCCAGGAAAAGGG + Intergenic
1123676345 15:22714000-22714022 CCCAGAAGGTGTCAGGGACAGGG - Intergenic
1123767801 15:23499180-23499202 CCCATTAGGCCCCAGGAAGCTGG - Intergenic
1124183683 15:27501988-27502010 CCCATAGGGGCCAAGTAACAAGG + Intronic
1124328563 15:28788262-28788284 CCCAGAAGGTGTCAGGGACAGGG - Intergenic
1125817281 15:42597219-42597241 CACTTAAGGTCCCAGCTACATGG - Intronic
1129188646 15:73925301-73925323 CCCTTCGGTTCCCAGGAACACGG + Intergenic
1129607792 15:77033227-77033249 CACATGAGGCCCCAGGGACAAGG - Intronic
1135236557 16:20761757-20761779 CCAATAAGATCTCAGGAACTGGG + Intronic
1136420996 16:30132923-30132945 CCTATAAAGTCCTAGGATCAAGG + Intergenic
1138748294 16:59389330-59389352 CCTATATAGTCCCAGGATCAAGG - Intergenic
1139168842 16:64605489-64605511 ACCTTAAGGTCCCAGCAAAAGGG + Intergenic
1141599816 16:85118834-85118856 GCCCGAAGGTCTCAGGAACAAGG - Intergenic
1141812093 16:86382642-86382664 CCCATCAGGATCCAGGAACTGGG + Intergenic
1142558998 17:798899-798921 CCCAGCAGGTCCCAGGCTCAAGG - Intergenic
1145309144 17:21692014-21692036 TCCATTAAGTCCCACGAACAGGG - Intergenic
1146522837 17:33539627-33539649 GCCATGAGGCCCCAGGCACAGGG - Intronic
1146530924 17:33607183-33607205 CCAATAAAGGCCAAGGAACAAGG + Intronic
1147048925 17:37776541-37776563 ACCATCAGGCACCAGGAACATGG - Intergenic
1147235638 17:39055528-39055550 CCCATAAGGGAACAGGCACAGGG - Intergenic
1147974722 17:44240193-44240215 CCCATAAACTGCTAGGAACAGGG + Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1148809466 17:50280747-50280769 CCCCAAAGATGCCAGGAACAGGG + Exonic
1149217714 17:54377211-54377233 TCCATTAGGTACCAGAAACACGG - Intergenic
1149662208 17:58339909-58339931 GCCATAAGATCCCAGGAAGCGGG - Intergenic
1149737276 17:59007714-59007736 CCCATATGGTTCCAGTAAAAAGG + Intronic
1152607395 17:81299608-81299630 CCCTTAGGGTCGCAGGACCAAGG + Intergenic
1153148242 18:2057989-2058011 CCTATAATGTCCCAGGGTCAAGG - Intergenic
1154314839 18:13296459-13296481 CACATGAGGACCCAGGGACATGG - Intronic
1154363738 18:13687703-13687725 CCTATAAAGTCCTAGGATCATGG + Intronic
1155754432 18:29472614-29472636 CCCTTAAGACCCAAGGAACAAGG - Intergenic
1156291246 18:35750371-35750393 CCTATAAAGTCCTAGGAGCAAGG - Intergenic
1157542560 18:48522038-48522060 CACAGAAGGTCACAGGGACACGG + Intergenic
1158235032 18:55302813-55302835 CCCAGGAGGTCACAGGAACTGGG - Intronic
1158945623 18:62444743-62444765 CCTATGAAGTCCCAGGATCAAGG + Intergenic
1159216123 18:65393104-65393126 CTTATAAGGTCCCAGAAACAGGG + Intergenic
1159602505 18:70441981-70442003 TCTATAAAGTCCCAGGATCAAGG + Intergenic
1159654408 18:71014644-71014666 CCTATAAAGTCCTAGGACCAAGG + Intergenic
1159891292 18:73955494-73955516 CCTATAAAGTCCCAGGATCAAGG + Intergenic
1160077612 18:75693225-75693247 CCCAGAGGGTCCCAGGGACCAGG - Intergenic
1161086637 19:2338569-2338591 CCCAGGAGGACCCAAGAACAGGG - Intronic
1161628206 19:5339002-5339024 CCCCTAGGGTCCCAAGGACAGGG - Intronic
1162589158 19:11579198-11579220 CCCAAAGGGTCCCAGGCAGATGG - Intronic
1164206977 19:23067284-23067306 CCCAAAAGGTGCCAGGAACAGGG + Intergenic
1165102418 19:33446787-33446809 CTGATAGGGTCCCAGGACCACGG + Intronic
1165993309 19:39827884-39827906 CCCAGAAGGGCCCAGGATCCGGG - Intronic
1168401039 19:56086576-56086598 CTCCCAAGGCCCCAGGAACATGG + Intergenic
1168517368 19:57018744-57018766 CTCATAAGGACCCTGGAACGAGG - Intergenic
925052633 2:829039-829061 CCCATAAGATCTCAGGAGCTGGG + Intergenic
925692766 2:6541851-6541873 CCTATAAAGTCCCAGGATCAAGG - Intergenic
929549387 2:42879892-42879914 ACCATAATGTCCCACGCACAGGG - Intergenic
931106499 2:59062443-59062465 CCCATAGGTAGCCAGGAACAGGG - Intergenic
933369460 2:81396748-81396770 CCAATAAGATCTCAGGAACTGGG + Intergenic
934665665 2:96168176-96168198 CCTATAAAGTCCTAGGATCAAGG + Intergenic
935546528 2:104405686-104405708 CCCAGAAGCTTCCAGGAAAAGGG + Intergenic
936041374 2:109152453-109152475 CCCATCAGGCACCCGGAACAAGG - Intronic
936877844 2:117213842-117213864 CCTATAAAGTCCTAGGATCAAGG + Intergenic
936956626 2:118029029-118029051 CCAATAAGATCTCAGGAACTGGG + Intergenic
937186182 2:120045415-120045437 CTCACATGGTCCCAGAAACATGG - Intronic
937428365 2:121818035-121818057 TCCATAAGGACCCAGGAACATGG - Intergenic
939250880 2:139680521-139680543 CCGATAAAGTCCTAGGATCAAGG - Intergenic
940710405 2:157155700-157155722 CCTATAAAGTCCTAGGATCAAGG + Intergenic
944150727 2:196555308-196555330 CACATAAGGACCCAGCAAGAAGG - Intronic
945041405 2:205746356-205746378 CCCATCAGCTCCCTGCAACAGGG - Intronic
945775593 2:214102931-214102953 CCCATGAAGTCCTAGCAACAAGG - Intronic
948127450 2:235574995-235575017 CACCTATGGTCCCAGGTACATGG + Intronic
1168752007 20:289315-289337 CCCACAAGGTCAAAGGAACCTGG + Intronic
1171185831 20:23123427-23123449 CCCCTAATGTCCCAGGGAGATGG - Intergenic
1175170055 20:57074086-57074108 CCAATAAGGTCCCATTCACAGGG + Intergenic
1175457103 20:59123738-59123760 CCCATTAATTCCCAGGAGCATGG + Intergenic
1175534502 20:59699095-59699117 CCCAGAAGATTCCAAGAACAGGG + Intronic
1175694562 20:61091815-61091837 CCCATAAAGTCCCTAGATCAGGG + Intergenic
1177059390 21:16352279-16352301 CCTATAAAGTCCCAGGATCAAGG + Intergenic
1179431525 21:41324432-41324454 CCAGTAAAGTCACAGGAACAGGG + Intronic
1181982791 22:26777924-26777946 CCCATAGGGTGTCAGGAATAGGG - Intergenic
1182369166 22:29798964-29798986 CCCAGAGGGCCCCAGGAACAAGG + Intronic
1183199332 22:36375027-36375049 ACCATCAGCTCCCAGAAACAAGG + Intronic
1183274534 22:36885328-36885350 CTCATGATGTACCAGGAACAGGG - Intergenic
951263422 3:20539516-20539538 CCTATAAAGTCCTAGGATCAAGG - Intergenic
952147709 3:30551203-30551225 CCTATAAAGTCCTAGGATCAAGG - Intergenic
952263352 3:31762029-31762051 CCTAAAAGATCCCAGGGACACGG + Intronic
953346902 3:42183620-42183642 CCCACACGGTCCCAGGCAAACGG - Intronic
956240760 3:67127613-67127635 CCCAGAATGTCCCAGGAAACAGG + Intergenic
959111003 3:102123270-102123292 CCCCTATGGACCCAGGCACAAGG - Intronic
961844725 3:129751962-129751984 GCAATTAGGTTCCAGGAACAAGG - Intronic
962240169 3:133745683-133745705 ACAAGAAGGTTCCAGGAACATGG - Intergenic
962938217 3:140101177-140101199 CCTATTATGTACCAGGAACATGG - Intronic
963353675 3:144183181-144183203 CAAATAAAGTCTCAGGAACAAGG + Intergenic
963719177 3:148840361-148840383 CCCAAAATGTCCCAGGTACCAGG + Intronic
966006306 3:175017501-175017523 ACAATAAGGTTCCAGGAAGAAGG - Intronic
968814490 4:2814959-2814981 ACCATCAGGTCCCTGGAAGAGGG + Intronic
969348446 4:6583786-6583808 CCTATAAAGTCCTAGGATCAAGG - Intronic
969844509 4:9909625-9909647 CCCATGAGGTGTCAGGAACTGGG + Intronic
971228428 4:24777054-24777076 CTCATAAAGACACAGGAACAAGG - Intergenic
971279377 4:25229999-25230021 CCTATAAAGTCCTAGGATCAAGG - Intronic
971860373 4:32094260-32094282 CCTATAAAGTCCCAGGATCAAGG - Intergenic
971949382 4:33325041-33325063 CCTATAATGTACCAGGAATATGG + Intergenic
972357918 4:38298459-38298481 CCCCTAAGGACCCAGGCACTAGG + Intergenic
973930512 4:55789185-55789207 CCCATAAAGTCCTATGATCACGG - Intergenic
974627877 4:64446965-64446987 CCTTTAAGGTCCCAGGATCAAGG + Intergenic
974876582 4:67710309-67710331 CCTATAAGGTCCTAGAATCAAGG - Intergenic
975060552 4:69992679-69992701 CCTATAAGGTCACTGCAACATGG + Intergenic
975656115 4:76642722-76642744 AGCATGAGGTGCCAGGAACAAGG + Intronic
975908516 4:79243864-79243886 CCCATAAAGTCCCAGGATCGAGG - Intronic
978153779 4:105466970-105466992 CCCATGAGATCTCAGGAACTGGG - Intronic
979769789 4:124508410-124508432 CCTATAAAGTCCTAAGAACAAGG + Intergenic
982203949 4:152983225-152983247 CCCATGAAGTCCAGGGAACAGGG - Intergenic
982988815 4:162244625-162244647 CCTATAAGATCTCAGGAACTGGG + Intergenic
987681795 5:21145433-21145455 CCAATAAGATCTCAGGAACTGGG + Intergenic
989183739 5:38603109-38603131 CCTATAAAGTCCCAGGGTCAAGG + Intronic
990521272 5:56583876-56583898 CCTATAAAGTCCTAGGATCAAGG - Intronic
991267848 5:64744031-64744053 CCAATAAGATCTCAGGAACCGGG + Intronic
994764005 5:103893138-103893160 CTGGTAAGGTCCCAGGAATATGG - Intergenic
994802274 5:104394117-104394139 CACATAAGTTGCCAGGAAAATGG - Intergenic
996280925 5:121728292-121728314 CTGATAAGATCCCAGGAACTGGG + Intergenic
997555790 5:134797475-134797497 CCCACAAGGGCCCATGACCAAGG - Intronic
997664256 5:135615943-135615965 CTCAAAGGGTCCCAGGTACATGG + Intergenic
1000286998 5:159835402-159835424 CCCATAAGATGCCAGGCACTGGG + Intergenic
1001649857 5:173308384-173308406 CCCAAAAGGTTCCTGGAGCAGGG - Intergenic
1002843763 6:927530-927552 CAGATGAGGTCCCAGGAACAAGG + Intergenic
1002947507 6:1777120-1777142 CCCATATGGTGCCTGGCACACGG - Intronic
1004487927 6:16085419-16085441 CTCCTAAGGTCCTAGGAAGAAGG + Intergenic
1006953122 6:37842016-37842038 CACATAAGGACACAGCAACAAGG - Intronic
1007841600 6:44720536-44720558 CCCATTAGCTCCCATGAGCAAGG - Intergenic
1007892334 6:45306984-45307006 CTCAGAAGGTCCCAGGCCCACGG + Intronic
1008454492 6:51693449-51693471 TTCACAAGGTCCCAGGCACATGG - Intronic
1009707323 6:67268320-67268342 CCCATAAGTCCACAGAAACATGG - Intergenic
1010562831 6:77371793-77371815 CCTATAAAGTCCCAGGATCAAGG - Intergenic
1014703667 6:124720752-124720774 CCCAGAGGATCCCAGGAACCAGG + Intronic
1016987481 6:149905952-149905974 CCCAGAAGTTCCCCGGAAGAGGG + Intergenic
1017058293 6:150457126-150457148 CCCAGAAAGTCCCAGGCAGATGG - Intergenic
1017408238 6:154142331-154142353 CCAATAAGATCTCAGGAACTGGG + Intronic
1018652638 6:166004914-166004936 TTCATAATGTCCCAGGGACATGG - Intergenic
1019817653 7:3212867-3212889 CCAGTAAGATCCCAGGAGCAGGG + Intergenic
1025611056 7:63075926-63075948 CCCAGAAAGTCCAGGGAACAGGG - Intergenic
1026275592 7:68872942-68872964 CCCTTAAAGTCCCAGGTCCAGGG - Intergenic
1027428946 7:78089946-78089968 GCCAGAAGGTCACAGGGACAAGG - Intronic
1028392558 7:90333988-90334010 CCTATAAAGTCCTAGGATCAAGG + Intergenic
1031090812 7:117351554-117351576 CCTATAAAGTCCTAGGATCATGG - Intergenic
1032072196 7:128815083-128815105 CCCATAACTTCACAGGAAAAGGG - Intronic
1032479941 7:132238346-132238368 TCCATAAAGTCGCTGGAACACGG - Intronic
1034310618 7:150084672-150084694 CTTATAAGGGCCGAGGAACAGGG + Intergenic
1034672452 7:152868970-152868992 CCCATCAGTTCCCAGGAAACAGG - Intergenic
1034796218 7:154015957-154015979 CTTATAAGGGCCGAGGAACAGGG - Intronic
1035271574 7:157722905-157722927 CCTACCAGGTGCCAGGAACAGGG - Intronic
1035289033 7:157825366-157825388 CCTCTGAGGTCCCAGAAACAAGG - Intronic
1036210842 8:6839953-6839975 CACATAAGGTCCCAGGCTCCAGG + Intergenic
1036621175 8:10425252-10425274 TCCATGAGGTCCCAGGCCCAGGG + Intronic
1037514110 8:19612504-19612526 CCCATAAAGGCCCAAGAAAAAGG + Intronic
1038256001 8:25951731-25951753 TCCATATGTTCCCAGGAAGAAGG + Intronic
1038958139 8:32489337-32489359 CCGATAAGGTCCCAGGAGTTGGG - Intronic
1041918576 8:63159865-63159887 CCTATAAAGTCCTAGGATCAAGG - Intergenic
1042854677 8:73254510-73254532 CCCAGGAGGTCACAGGAACTGGG + Intronic
1042863115 8:73333433-73333455 CCTATAAAGTCCTAGGATCAAGG + Intergenic
1043599484 8:81919901-81919923 CCCATAAGATCTCAGGAGCTGGG + Intergenic
1044003733 8:86916596-86916618 CCAATAAGATCCCAGGAATTGGG - Intronic
1044088240 8:87968481-87968503 CCTATAAAGTCCTAGGACCAAGG + Intergenic
1048287664 8:133154365-133154387 ACCATAAGGTCCCTAGAACCTGG - Intergenic
1050268673 9:3918495-3918517 CCCATAAGGTACCATGAAGACGG - Intronic
1051080532 9:13288615-13288637 CCTATAAAGTCCTAGGATCAAGG + Intergenic
1052620170 9:30898475-30898497 CCTATGAAGTCCCAGGATCAAGG + Intergenic
1053162881 9:35825739-35825761 CCAATGAGGTCCCATGGACAAGG - Exonic
1053434636 9:38067155-38067177 CCCATAAGGTCCCAGGAACACGG - Intronic
1056303701 9:85268738-85268760 TCCACAAGGTCCCAGGGACCTGG + Intergenic
1057373237 9:94493223-94493245 CCTATAAAGACACAGGAACATGG - Intergenic
1058183271 9:101823663-101823685 CCCTTTAGTTCCCAGGGACAGGG - Intergenic
1060953833 9:127623557-127623579 GCCAACAGGTCCCAGGAAAAAGG + Intronic
1061287858 9:129634363-129634385 CCCATAAGGTGTCAGGACCAGGG + Intronic
1185691576 X:2159343-2159365 CCAAGAAGGTCCCAAGAAGATGG - Intergenic
1186021789 X:5264459-5264481 CCTATAAAGTCCTAGGATCAAGG + Intergenic
1187670158 X:21658619-21658641 ACCAGAGGGTCCCAGGAACCCGG + Intergenic
1188752191 X:33918766-33918788 CCTATAAAGTCCTAGGATCAAGG - Intergenic
1188752810 X:33924391-33924413 CCTATAAAGTCCTAGGATCATGG - Intergenic
1188811974 X:34661711-34661733 CCCATAAGGTCCCAGGACAGGGG - Intergenic
1189437479 X:41005876-41005898 GGCAGAAGGTCCCAGGAGCATGG - Intergenic
1194130938 X:90081053-90081075 CCTATAAAGTCCTAGGATCAAGG - Intergenic
1194553063 X:95324997-95325019 CCTATAAAGTCCTAGGATCAAGG - Intergenic
1194916865 X:99718013-99718035 CCCCTATGGGCCCAGGACCAAGG + Intergenic
1195318655 X:103703188-103703210 CCTATAAAGTCCTAGGATCATGG - Intergenic
1195761795 X:108254417-108254439 TCCATAAGGTGGCAGAAACAGGG + Intronic
1196419820 X:115509938-115509960 CCTATAAAGTCCCAGGATCAAGG - Intergenic
1197938088 X:131761265-131761287 CCTATAAGGTCCCATGATCAAGG + Intergenic
1197939707 X:131777041-131777063 CCTATAAGGTCCCATGATCAAGG + Intergenic
1198119655 X:133579411-133579433 CCAATTAGGTCCCAGGCACTGGG + Intronic
1199404764 X:147444032-147444054 CCCATGAAGTCCTAGGATCAAGG + Intergenic
1200009403 X:153109769-153109791 CCTATAAAGTCCCAGGGTCAAGG + Intergenic
1200030197 X:153290153-153290175 CCTATAAAGTCCCAGGGTCAAGG - Intergenic
1201653324 Y:16315461-16315483 CCTATAAAGTCCTAGGATCAGGG + Intergenic