ID: 1053434908

View in Genome Browser
Species Human (GRCh38)
Location 9:38068291-38068313
Sequence CGCTGCCGCCGCAGTAGTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053434899_1053434908 10 Left 1053434899 9:38068258-38068280 CCGAGAAGGCGCGCTGGACCCCG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1053434902_1053434908 -9 Left 1053434902 9:38068277-38068299 CCCGCCTGGCTCCCCGCTGCCGC 0: 1
1: 0
2: 3
3: 64
4: 566
Right 1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1053434895_1053434908 26 Left 1053434895 9:38068242-38068264 CCCGACGCGGACGAGGCCGAGAA 0: 1
1: 0
2: 4
3: 7
4: 39
Right 1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1053434896_1053434908 25 Left 1053434896 9:38068243-38068265 CCGACGCGGACGAGGCCGAGAAG 0: 1
1: 0
2: 2
3: 6
4: 39
Right 1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1053434901_1053434908 -8 Left 1053434901 9:38068276-38068298 CCCCGCCTGGCTCCCCGCTGCCG 0: 1
1: 0
2: 1
3: 50
4: 427
Right 1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1053434903_1053434908 -10 Left 1053434903 9:38068278-38068300 CCGCCTGGCTCCCCGCTGCCGCC 0: 1
1: 0
2: 0
3: 76
4: 615
Right 1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053434908 Original CRISPR CGCTGCCGCCGCAGTAGTCC AGG Exonic
900175878 1:1291159-1291181 CGCTGCCCCCGCTCTAGCCCAGG - Intronic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901828606 1:11878773-11878795 CGCTGCAGCCGCAGGAAGCCCGG - Intergenic
902984618 1:20148115-20148137 CCCTTCCCCAGCAGTAGTCCTGG + Intronic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
910288227 1:85577205-85577227 CGCTCCCTCCGCAGGGGTCCCGG + Intronic
912786140 1:112605745-112605767 CACTGCCACCCCAGTAGGCCTGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922719174 1:227891638-227891660 GGCTGCAGCCGCAGTGGCCCAGG + Intergenic
1069375789 10:67791171-67791193 CACTGACTCCCCAGTAGTCCTGG + Intergenic
1069893628 10:71667105-71667127 AGCTGCCTCCGCAGCAGCCCTGG - Intronic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1077551811 11:3203765-3203787 GGCTGCAGCCGCTGCAGTCCAGG + Intergenic
1081699993 11:45146851-45146873 CGCGGCTGCCGCAGCATTCCCGG + Intronic
1083246208 11:61429913-61429935 CGCCGCCGCCGCCATATTCCCGG - Intronic
1083741419 11:64713474-64713496 CGCAGTCGCCGCCGTCGTCCAGG + Exonic
1084680102 11:70662033-70662055 CGCTGCCGCCGCCGCCGTTCGGG - Intronic
1084973034 11:72781709-72781731 CGCCGCCGCCGCAGCTGCCCGGG + Intronic
1085255832 11:75172443-75172465 CGCTGCCGGTGCAGTGGCCCTGG + Exonic
1085503125 11:77040379-77040401 CGCCGCCGCTGCAGTACACCGGG - Exonic
1096598682 12:52714411-52714433 GGCTGACGGCGCAGGAGTCCCGG + Intergenic
1103400676 12:120641002-120641024 CGGCGACGCCGCAGTCGTCCGGG + Exonic
1104623988 12:130338117-130338139 CGCTGCCCTCGCCCTAGTCCTGG - Exonic
1106170853 13:27286696-27286718 CTCTGCCACGGCCGTAGTCCAGG - Intergenic
1106385571 13:29282246-29282268 TGCTGCCTCTGCAGCAGTCCAGG + Intronic
1107779105 13:43879516-43879538 CGCTGCTGCCTCAGCAGTTCCGG - Exonic
1108227461 13:48303954-48303976 CGCTGCCGCCGCGGAACCCCCGG + Exonic
1110503197 13:76253334-76253356 TGCTGCCACCCCAGTAGGCCTGG - Intergenic
1117424418 14:55580243-55580265 CGCCGCCGCCGCAGTCGCTCAGG - Intronic
1118388816 14:65279752-65279774 GGCTGCCGCCGGGGCAGTCCAGG - Intergenic
1127157625 15:56145783-56145805 CACTGCCACCACAGTAGTCTAGG + Intronic
1129893779 15:79089476-79089498 CGCCGCCGCCGCCGCAGTCGCGG - Intronic
1129893794 15:79089539-79089561 CGCTGCCTCCGCAGCAGCCCTGG + Intronic
1129983712 15:79897291-79897313 CGCTGCCGCCTCCGCGGTCCCGG - Intronic
1133188397 16:4116174-4116196 CGCCGCGGCCGCAGCTGTCCCGG + Exonic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1143742582 17:8965417-8965439 CGCTGCCCCCGCGGTGGGCCAGG + Intronic
1145747772 17:27332843-27332865 CGCGGCCGGCGCAGGCGTCCAGG + Intergenic
1152121541 17:78421912-78421934 GGCGGCCGCCGCAGTCCTCCCGG + Intronic
1155199328 18:23503522-23503544 CGCAGCCGCCGCTACAGTCCGGG + Exonic
1156388805 18:36631076-36631098 CACTGCCGCATCAGTACTCCTGG - Intronic
1157662819 18:49460480-49460502 CGCTGTCGCCGCCGCAGCCCAGG + Exonic
1157799415 18:50606877-50606899 CACTGCCGCTGCTGTAATCCTGG + Intronic
1160739804 19:680556-680578 GGCTGCTGCCGCAGTAGGCGGGG + Intronic
1163517586 19:17774432-17774454 CGCTCCCGCCGGCTTAGTCCTGG - Exonic
1164982742 19:32626556-32626578 CTCTGCTGCAGCAGTAGTCAGGG - Intronic
1165076313 19:33281659-33281681 TGCTGCCTCCCCAGTAGCCCAGG - Intergenic
1165443902 19:35846150-35846172 CGCGGCTGCCGCAGGAGTCGCGG - Exonic
1165850893 19:38849810-38849832 CACTGCCGCCGCCGTAGTAGCGG + Exonic
1165956961 19:39507118-39507140 CGCGGCCCGCGCAGTCGTCCAGG - Exonic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
935891913 2:107688141-107688163 GTCTGCCGCCGCAGTGGGCCAGG - Intergenic
938305508 2:130251880-130251902 CGCTGCAGCCGGTGCAGTCCTGG + Intergenic
938824785 2:134993932-134993954 CGCTGCAGCCTCAATATTCCAGG - Intronic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
948207742 2:236171577-236171599 CGCTGCCGCCGCCAGAGTCGAGG + Intergenic
1168875530 20:1169531-1169553 TGCTGCTGACGCATTAGTCCTGG + Intronic
1169664522 20:8019500-8019522 CGCTGCCGCCGGAGCAGAGCCGG - Exonic
1175605896 20:60311988-60312010 AGATGCCGCCGCAGTTATCCAGG + Intergenic
1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG + Exonic
1181085126 22:20436392-20436414 CGCCGCCGCCGCTGCATTCCTGG + Intronic
1183702502 22:39457990-39458012 GGCTGCCGCCGCCGCAGTCTGGG - Intronic
1184412134 22:44331602-44331624 CGCCGCCGCAACAGTTGTCCGGG + Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
954912652 3:54122270-54122292 CTCAGCGGCCGCAGTAGCCCGGG + Intergenic
962583506 3:136819111-136819133 CTCTCCCTCCGCAGTACTCCGGG + Exonic
969138606 4:5050806-5050828 GGCTCCCGCCGCAGGAGCCCAGG + Intergenic
971185638 4:24373148-24373170 TGCTCACGCCGCAGGAGTCCGGG - Intergenic
978750395 4:112239641-112239663 CGCTGCTGCCACATTAATCCAGG + Intronic
983904362 4:173168974-173168996 CGCTGCCGCCGGAGGGGGCCGGG - Intronic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
1002184260 5:177446959-177446981 CGCAGCCGCCGCGGTACTCACGG - Exonic
1004734074 6:18387363-18387385 CGCTCCCGCTGCAACAGTCCCGG + Exonic
1017311559 6:152982713-152982735 CGCTGCCGCCGCCCGAGGCCGGG + Intronic
1019601143 7:1884396-1884418 CGCTGAGGCTGCAGGAGTCCAGG - Intronic
1020137016 7:5593260-5593282 CGGTGCCGCCGAAGTAGCGCCGG - Exonic
1023844410 7:44112848-44112870 CCATGCCGCCGGTGTAGTCCTGG - Exonic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1026760938 7:73125201-73125223 CGCTGCTGCCTCACTGGTCCTGG + Intergenic
1027037280 7:74933997-74934019 CGCTGCTGCCTCACTGGTCCTGG + Intergenic
1027086282 7:75267455-75267477 CGCTGCTGCCTCACTGGTCCTGG - Intergenic
1029392585 7:100285482-100285504 CGCTGCTGCCTCACTGGTCCTGG - Intergenic
1031030628 7:116730531-116730553 AGAAGCCGCCGCAGTAGTCCAGG + Intronic
1031899290 7:127392275-127392297 AGCCGCCGCCGCAGTCGTCTCGG - Exonic
1032833283 7:135650927-135650949 CACTGCAGCAGCAGTAGTCGGGG - Intergenic
1034441132 7:151086616-151086638 CGCCGCCAGCCCAGTAGTCCCGG + Intronic
1038002624 8:23404198-23404220 GGCGGCCGCCGCAGCAGGCCCGG + Exonic
1038029480 8:23624608-23624630 GGCTGTCTTCGCAGTAGTCCAGG - Intergenic
1038429857 8:27491324-27491346 CGCCGCCGCCGCAGTGGGTCGGG + Intronic
1042681659 8:71392338-71392360 CGCTGTAGCTGCAGAAGTCCAGG - Intergenic
1044781652 8:95749923-95749945 CGGGGCCGCTGCAGGAGTCCTGG + Intergenic
1049226198 8:141451694-141451716 CGCTGCCACCACCCTAGTCCAGG - Intergenic
1049369613 8:142257573-142257595 CCCTGCCGCTGCAGGGGTCCAGG + Intronic
1049788577 8:144462775-144462797 CGCCGCCGCCTCAGTGGGCCCGG + Intronic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1057259764 9:93576983-93577005 CGCCGCCGCCGCCGCATTCCGGG + Intronic
1061514198 9:131079141-131079163 CCCTGCAGCCTCAGAAGTCCCGG + Exonic
1189324667 X:40105336-40105358 CGCCGCCGCCGCCGCAGTCACGG + Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1199686777 X:150272140-150272162 TCCTGCCTCTGCAGTAGTCCAGG - Intergenic