ID: 1053448785

View in Genome Browser
Species Human (GRCh38)
Location 9:38175189-38175211
Sequence TTTCACTTAGCCTGTCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053448785_1053448787 4 Left 1053448785 9:38175189-38175211 CCTTGAAGACAGGCTAAGTGAAA No data
Right 1053448787 9:38175216-38175238 GTAAGTCAGACACAAAAGGACGG No data
1053448785_1053448789 26 Left 1053448785 9:38175189-38175211 CCTTGAAGACAGGCTAAGTGAAA No data
Right 1053448789 9:38175238-38175260 GATACTGAGGTGCCTAGAATAGG No data
1053448785_1053448788 13 Left 1053448785 9:38175189-38175211 CCTTGAAGACAGGCTAAGTGAAA No data
Right 1053448788 9:38175225-38175247 ACACAAAAGGACGGATACTGAGG No data
1053448785_1053448786 0 Left 1053448785 9:38175189-38175211 CCTTGAAGACAGGCTAAGTGAAA No data
Right 1053448786 9:38175212-38175234 TGAAGTAAGTCAGACACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053448785 Original CRISPR TTTCACTTAGCCTGTCTTCA AGG (reversed) Intergenic
No off target data available for this crispr