ID: 1053448789

View in Genome Browser
Species Human (GRCh38)
Location 9:38175238-38175260
Sequence GATACTGAGGTGCCTAGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053448785_1053448789 26 Left 1053448785 9:38175189-38175211 CCTTGAAGACAGGCTAAGTGAAA No data
Right 1053448789 9:38175238-38175260 GATACTGAGGTGCCTAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053448789 Original CRISPR GATACTGAGGTGCCTAGAAT AGG Intergenic
No off target data available for this crispr