ID: 1053449315

View in Genome Browser
Species Human (GRCh38)
Location 9:38179970-38179992
Sequence TGCCATTCCCCTGGTTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053449315_1053449321 -4 Left 1053449315 9:38179970-38179992 CCCAAACAACCAGGGGAATGGCA No data
Right 1053449321 9:38179989-38180011 GGCAGGCATGAATGGCTGCTGGG No data
1053449315_1053449323 5 Left 1053449315 9:38179970-38179992 CCCAAACAACCAGGGGAATGGCA No data
Right 1053449323 9:38179998-38180020 GAATGGCTGCTGGGCCAGCAGGG No data
1053449315_1053449322 4 Left 1053449315 9:38179970-38179992 CCCAAACAACCAGGGGAATGGCA No data
Right 1053449322 9:38179997-38180019 TGAATGGCTGCTGGGCCAGCAGG No data
1053449315_1053449325 12 Left 1053449315 9:38179970-38179992 CCCAAACAACCAGGGGAATGGCA No data
Right 1053449325 9:38180005-38180027 TGCTGGGCCAGCAGGGAGATGGG No data
1053449315_1053449320 -5 Left 1053449315 9:38179970-38179992 CCCAAACAACCAGGGGAATGGCA No data
Right 1053449320 9:38179988-38180010 TGGCAGGCATGAATGGCTGCTGG No data
1053449315_1053449324 11 Left 1053449315 9:38179970-38179992 CCCAAACAACCAGGGGAATGGCA No data
Right 1053449324 9:38180004-38180026 CTGCTGGGCCAGCAGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053449315 Original CRISPR TGCCATTCCCCTGGTTGTTT GGG (reversed) Intergenic
No off target data available for this crispr