ID: 1053454808

View in Genome Browser
Species Human (GRCh38)
Location 9:38225873-38225895
Sequence CCTCATCTGTAAAAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053454800_1053454808 -4 Left 1053454800 9:38225854-38225876 CCTCTCTGTTCCTCAGTTGCCTC No data
Right 1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053454808 Original CRISPR CCTCATCTGTAAAAGGTGGG GGG Intergenic
No off target data available for this crispr