ID: 1053461692

View in Genome Browser
Species Human (GRCh38)
Location 9:38276518-38276540
Sequence GGTTGCAAACTGATGGCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053461692_1053461695 8 Left 1053461692 9:38276518-38276540 CCGTGGGCCATCAGTTTGCAACC No data
Right 1053461695 9:38276549-38276571 GTCCTTGCCGTTTAGCTAACTGG No data
1053461692_1053461698 21 Left 1053461692 9:38276518-38276540 CCGTGGGCCATCAGTTTGCAACC No data
Right 1053461698 9:38276562-38276584 AGCTAACTGGTTCATGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053461692 Original CRISPR GGTTGCAAACTGATGGCCCA CGG (reversed) Intergenic
No off target data available for this crispr