ID: 1053461695

View in Genome Browser
Species Human (GRCh38)
Location 9:38276549-38276571
Sequence GTCCTTGCCGTTTAGCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053461693_1053461695 1 Left 1053461693 9:38276525-38276547 CCATCAGTTTGCAACCTCTTGTC No data
Right 1053461695 9:38276549-38276571 GTCCTTGCCGTTTAGCTAACTGG No data
1053461691_1053461695 13 Left 1053461691 9:38276513-38276535 CCAAGCCGTGGGCCATCAGTTTG No data
Right 1053461695 9:38276549-38276571 GTCCTTGCCGTTTAGCTAACTGG No data
1053461692_1053461695 8 Left 1053461692 9:38276518-38276540 CCGTGGGCCATCAGTTTGCAACC No data
Right 1053461695 9:38276549-38276571 GTCCTTGCCGTTTAGCTAACTGG No data
1053461688_1053461695 26 Left 1053461688 9:38276500-38276522 CCATGGGACAAATCCAAGCCGTG No data
Right 1053461695 9:38276549-38276571 GTCCTTGCCGTTTAGCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053461695 Original CRISPR GTCCTTGCCGTTTAGCTAAC TGG Intergenic
No off target data available for this crispr