ID: 1053461908

View in Genome Browser
Species Human (GRCh38)
Location 9:38277946-38277968
Sequence CAGCAAGTTGAGATGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053461908_1053461916 15 Left 1053461908 9:38277946-38277968 CCGGGCTCCATCTCAACTTGCTG No data
Right 1053461916 9:38277984-38278006 TCCTCCCCAAGCCCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053461908 Original CRISPR CAGCAAGTTGAGATGGAGCC CGG (reversed) Intergenic
No off target data available for this crispr