ID: 1053461916

View in Genome Browser
Species Human (GRCh38)
Location 9:38277984-38278006
Sequence TCCTCCCCAAGCCCCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053461907_1053461916 20 Left 1053461907 9:38277941-38277963 CCAGGCCGGGCTCCATCTCAACT No data
Right 1053461916 9:38277984-38278006 TCCTCCCCAAGCCCCCTCCCAGG No data
1053461908_1053461916 15 Left 1053461908 9:38277946-38277968 CCGGGCTCCATCTCAACTTGCTG No data
Right 1053461916 9:38277984-38278006 TCCTCCCCAAGCCCCCTCCCAGG No data
1053461910_1053461916 8 Left 1053461910 9:38277953-38277975 CCATCTCAACTTGCTGGAGCTCT No data
Right 1053461916 9:38277984-38278006 TCCTCCCCAAGCCCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053461916 Original CRISPR TCCTCCCCAAGCCCCCTCCC AGG Intergenic
No off target data available for this crispr