ID: 1053462694

View in Genome Browser
Species Human (GRCh38)
Location 9:38282821-38282843
Sequence GCAGAAGTGGGGCTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053462685_1053462694 8 Left 1053462685 9:38282790-38282812 CCACTGTGTGCTCAAGCACTTAC No data
Right 1053462694 9:38282821-38282843 GCAGAAGTGGGGCTGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053462694 Original CRISPR GCAGAAGTGGGGCTGGGGGC TGG Intergenic
No off target data available for this crispr