ID: 1053466974

View in Genome Browser
Species Human (GRCh38)
Location 9:38315866-38315888
Sequence CTCGTTGACTGGCAGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053466974_1053466978 -2 Left 1053466974 9:38315866-38315888 CCACCAGGCTGCCAGTCAACGAG No data
Right 1053466978 9:38315887-38315909 AGCAGGTCCCTACTCCTCTCTGG No data
1053466974_1053466984 29 Left 1053466974 9:38315866-38315888 CCACCAGGCTGCCAGTCAACGAG No data
Right 1053466984 9:38315918-38315940 GACCCCATCGGAATAGTGTAAGG No data
1053466974_1053466982 17 Left 1053466974 9:38315866-38315888 CCACCAGGCTGCCAGTCAACGAG No data
Right 1053466982 9:38315906-38315928 CTGGACTTCCGTGACCCCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053466974 Original CRISPR CTCGTTGACTGGCAGCCTGG TGG (reversed) Intergenic