ID: 1053466974 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:38315866-38315888 |
| Sequence | CTCGTTGACTGGCAGCCTGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053466974_1053466978 | -2 | Left | 1053466974 | 9:38315866-38315888 | CCACCAGGCTGCCAGTCAACGAG | No data | ||
| Right | 1053466978 | 9:38315887-38315909 | AGCAGGTCCCTACTCCTCTCTGG | No data | ||||
| 1053466974_1053466984 | 29 | Left | 1053466974 | 9:38315866-38315888 | CCACCAGGCTGCCAGTCAACGAG | No data | ||
| Right | 1053466984 | 9:38315918-38315940 | GACCCCATCGGAATAGTGTAAGG | No data | ||||
| 1053466974_1053466982 | 17 | Left | 1053466974 | 9:38315866-38315888 | CCACCAGGCTGCCAGTCAACGAG | No data | ||
| Right | 1053466982 | 9:38315906-38315928 | CTGGACTTCCGTGACCCCATCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053466974 | Original CRISPR | CTCGTTGACTGGCAGCCTGG TGG (reversed) | Intergenic | ||