ID: 1053476298

View in Genome Browser
Species Human (GRCh38)
Location 9:38384413-38384435
Sequence CATTCTAGGGATCAGAAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053476298_1053476308 28 Left 1053476298 9:38384413-38384435 CCCGCCTTCTGATCCCTAGAATG No data
Right 1053476308 9:38384464-38384486 TGAAGACAGTTTCCCCTGCTAGG No data
1053476298_1053476309 29 Left 1053476298 9:38384413-38384435 CCCGCCTTCTGATCCCTAGAATG No data
Right 1053476309 9:38384465-38384487 GAAGACAGTTTCCCCTGCTAGGG No data
1053476298_1053476310 30 Left 1053476298 9:38384413-38384435 CCCGCCTTCTGATCCCTAGAATG No data
Right 1053476310 9:38384466-38384488 AAGACAGTTTCCCCTGCTAGGGG No data
1053476298_1053476305 0 Left 1053476298 9:38384413-38384435 CCCGCCTTCTGATCCCTAGAATG No data
Right 1053476305 9:38384436-38384458 TAGATGTGGTGGCTGCCATTTGG No data
1053476298_1053476306 1 Left 1053476298 9:38384413-38384435 CCCGCCTTCTGATCCCTAGAATG No data
Right 1053476306 9:38384437-38384459 AGATGTGGTGGCTGCCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053476298 Original CRISPR CATTCTAGGGATCAGAAGGC GGG (reversed) Intergenic
No off target data available for this crispr