ID: 1053477676

View in Genome Browser
Species Human (GRCh38)
Location 9:38393720-38393742
Sequence CTGAGTCAGCAGATCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053477676_1053477678 -10 Left 1053477676 9:38393720-38393742 CCCTGGCAGATCTGCTGACTCAG 0: 1
1: 1
2: 3
3: 32
4: 306
Right 1053477678 9:38393733-38393755 GCTGACTCAGCTTCCCCCTGTGG No data
1053477676_1053477680 2 Left 1053477676 9:38393720-38393742 CCCTGGCAGATCTGCTGACTCAG 0: 1
1: 1
2: 3
3: 32
4: 306
Right 1053477680 9:38393745-38393767 TCCCCCTGTGGGATATGATGAGG No data
1053477676_1053477679 -9 Left 1053477676 9:38393720-38393742 CCCTGGCAGATCTGCTGACTCAG 0: 1
1: 1
2: 3
3: 32
4: 306
Right 1053477679 9:38393734-38393756 CTGACTCAGCTTCCCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053477676 Original CRISPR CTGAGTCAGCAGATCTGCCA GGG (reversed) Intronic
900435575 1:2629162-2629184 CTGAGTCCGCAGCTCGGCCCCGG + Intronic
900609587 1:3538899-3538921 CTGGGACATCAGAGCTGCCAGGG + Intronic
902338069 1:15765178-15765200 CTGTGGCTGCAGCTCTGCCAGGG - Exonic
902338239 1:15766065-15766087 CTGATTCAGCAGATCTGCCGTGG + Intronic
904440743 1:30527912-30527934 GTGACTCAGCAGATCCACCACGG + Intergenic
905816102 1:40952298-40952320 CTGATTCAGCAGGTCTGCAGTGG + Intergenic
905927606 1:41762979-41763001 CTGAGCCTGCAGGCCTGCCAAGG + Intronic
908983206 1:69983897-69983919 CTGATTCAGCAGATCTGGGGTGG + Intronic
909350552 1:74648031-74648053 CTGAATCAGAAGCTCTGCTAAGG - Intronic
909542050 1:76802333-76802355 CAAAGTCAGAAGAACTGCCAGGG + Intergenic
910011925 1:82475043-82475065 ATCAGACACCAGATCTGCCAGGG - Intergenic
910516835 1:88071172-88071194 TTGAGTCATGAGATCAGCCATGG - Intergenic
912480459 1:109978616-109978638 CTGGGGGAGCACATCTGCCAGGG + Intergenic
912487295 1:110039332-110039354 CTGAGTGGGCAGAGGTGCCAGGG - Intronic
913122538 1:115754967-115754989 CTGATTCAGCAGGTCTGGGATGG + Intronic
913664059 1:121031249-121031271 CTGAATCAGCAGAAATGGCAGGG + Intergenic
914015451 1:143814528-143814550 CTGAATCAGCAGAAATGGCAGGG + Intergenic
914162333 1:145146480-145146502 CTGAATCAGCAGAAATGGCAGGG - Intergenic
914654069 1:149723069-149723091 CTGAATCAGCAGAAATGGCAGGG + Intergenic
914811780 1:151033990-151034012 CTGAGACAGCAGATGTGTCCAGG + Exonic
915142889 1:153777902-153777924 CTGTGTCAGCAGCTCTGCCCAGG - Intronic
915194008 1:154175551-154175573 CTGATTCAGCAGATCAGCATAGG + Intronic
917357411 1:174141299-174141321 CTGGTTCAGCAGATGTTCCAGGG - Intergenic
917837250 1:178951159-178951181 CTGAGTCAGCAGATTTGTTTGGG - Intergenic
917923849 1:179772502-179772524 CTGAATCAGCAGATTTGGAATGG - Intronic
918038486 1:180897651-180897673 CTGAGGCAGCTGCTCTCCCAAGG - Intergenic
918068073 1:181114996-181115018 CTGACTCAGCAGGTCTGGGATGG - Intergenic
918318094 1:183339993-183340015 GTGACTCTGCTGATCTGCCAAGG - Intronic
919353592 1:196492777-196492799 CTGAATAAGTAGATCTGGCACGG - Intronic
919871448 1:201824844-201824866 CTGATTCAGCAGATCTGGGATGG - Exonic
920340025 1:205269809-205269831 CTGAGTCTTCAGGTCTTCCATGG - Exonic
920532806 1:206716565-206716587 CTGAGTCCACAGATCTCACAGGG - Intronic
920746991 1:208638265-208638287 CTGATTCAACAGATCTGGGATGG - Intergenic
922439604 1:225642534-225642556 CTGAGACTGCAGATGTGCTACGG - Intronic
922731468 1:227950608-227950630 CTGAGGCAGCAGGTAGGCCACGG - Intergenic
923168998 1:231395813-231395835 CTGAATCAGTAGGTCTGGCATGG - Intronic
924439443 1:244074173-244074195 CTGAGGCAGCAGCCCAGCCAGGG + Intergenic
924657633 1:245987947-245987969 CTGCTTCAGCTGATCTGGCATGG + Intronic
1062900544 10:1141986-1142008 CTCACTCAGGAGAACTGCCACGG - Intergenic
1063614906 10:7592998-7593020 CTAAAGCAGCAGCTCTGCCATGG - Intronic
1063688040 10:8257261-8257283 CTGAGTCAGCAGGTCTGGAAGGG - Intergenic
1066591725 10:37002007-37002029 CTGAGTCTGGAGCTCTGACAGGG + Intergenic
1067766154 10:49088969-49088991 CTGATTCAGTAGATCCGGCATGG - Intronic
1068090755 10:52429813-52429835 CTGATTCAGCAGGTCTGGCATGG + Intergenic
1068854069 10:61779475-61779497 CTAAGTCAGCATTTCTCCCAGGG + Intergenic
1069962777 10:72088117-72088139 GTGAGTCCGCAGGGCTGCCAAGG - Intronic
1070489487 10:76963316-76963338 CTAATTCAGCAGATCTGGCCTGG - Intronic
1073256763 10:102157177-102157199 CTACCTCAGCAGGTCTGCCAAGG + Exonic
1073478819 10:103772665-103772687 CTGATTCGGCAGCTCTCCCAGGG + Intronic
1073480285 10:103782264-103782286 CTGATTCAGCAGGTCCGCCTGGG - Intronic
1074125287 10:110524390-110524412 CTGAGTCAGCAGCTCTAACAGGG - Intergenic
1074278163 10:112024573-112024595 GAGAGCCAGCACATCTGCCATGG + Intergenic
1074504772 10:114059910-114059932 CTCCTTCTGCAGATCTGCCATGG - Intergenic
1074727276 10:116324675-116324697 CTGAGTCAGGGGTTCCGCCAGGG + Intronic
1074777048 10:116774464-116774486 CTGGGTCAGTAGATCTGCCTTGG - Intergenic
1077343306 11:2035566-2035588 CTGTGTCCTCAGATCTGCCGGGG - Intergenic
1077417890 11:2433332-2433354 ATCAGACAGCAGATCTGCAAAGG + Intergenic
1078388136 11:10911069-10911091 CTGATTCAGCATATCTGGGATGG + Intergenic
1080845183 11:36020760-36020782 CTGGGTCAGCAGAGGTGCCCTGG - Intronic
1081487102 11:43539249-43539271 CTGAGTTAGCAGCTCTGCAAAGG - Intergenic
1081857565 11:46313219-46313241 CTGATTCAGTAGACCTGGCATGG - Intronic
1082221467 11:49643515-49643537 CTGAGTCAGTAGATCTGGGTTGG + Intergenic
1085384108 11:76146722-76146744 CTAAGGCAGCTCATCTGCCAGGG - Intergenic
1086627573 11:88975637-88975659 CTGAGTCAGTAGATCTGGGTTGG - Intronic
1086949573 11:92877616-92877638 CTGAGTCAGTAGCTTTGTCATGG - Intronic
1087081170 11:94172365-94172387 CTGATTCAGCAGGTCTGATAGGG + Intronic
1089996956 11:122917513-122917535 CTGACTCAGGAGGTCTGGCATGG - Intronic
1090358646 11:126157776-126157798 CTGAGTCAACAGGCCTCCCATGG + Intergenic
1091007375 11:131965813-131965835 CTGAGTTTTCAAATCTGCCATGG + Intronic
1202826292 11_KI270721v1_random:90755-90777 CTGTGTCCTCAGATCTGCCGGGG - Intergenic
1092092374 12:5813446-5813468 CTGATTCAGCAAATGTGGCATGG + Intronic
1092363974 12:7861727-7861749 CTGAGGCAGCAGATCTCCTGAGG + Intronic
1092380576 12:7993460-7993482 CTGACTCAGCAAATCTGGCGTGG + Intergenic
1093520258 12:20041788-20041810 CTGATTCAGTAGATCTGGGATGG - Intergenic
1094039455 12:26107670-26107692 CTGATTCAGTAGATCTGGAATGG + Intergenic
1095605844 12:44066472-44066494 CTGAATCTGCATATCTCCCAAGG - Intronic
1099424553 12:82505999-82506021 CTGGGGCAGAAGAACTGCCAAGG - Intergenic
1099842306 12:87981449-87981471 CTGATTCAGCAGGTCTGAGATGG + Intronic
1103024192 12:117560173-117560195 CTGATTCAGCAGATCTGCCAGGG - Intronic
1103064990 12:117890037-117890059 CTGAGTCAGCAGCTGTGGCAGGG - Intronic
1103996751 12:124834989-124835011 CTGAGTCGGCAGACCTGGCATGG - Intronic
1104935034 12:132359965-132359987 CTGAGTTTGCAGAAATGCCATGG + Intergenic
1106467732 13:30027677-30027699 CTGAGTCTGCAGACCTAACATGG - Intergenic
1107988626 13:45797646-45797668 CTGATACAGCAGGTCTGGCATGG + Intronic
1108030883 13:46228358-46228380 CTGACCTTGCAGATCTGCCAAGG + Intronic
1108143638 13:47453167-47453189 CAGATTCAGCAGATCTGGGATGG - Intergenic
1109631421 13:65053945-65053967 CAGAGTCATCAGATCGACCAAGG + Intergenic
1109632171 13:65064242-65064264 TTGATTCAGCAGGTCTGCAATGG - Intergenic
1110797308 13:79654692-79654714 CTGATTCAGCAGGTCTGGAATGG + Intergenic
1112033187 13:95475369-95475391 CAGGCTCAGCAGATCTGCCCAGG - Intronic
1112374077 13:98822502-98822524 CTGACTCGGCAGAGGTGCCAGGG + Intronic
1112827137 13:103404659-103404681 CTGATTCAGCAGATCTGGGGTGG + Intergenic
1112921627 13:104620776-104620798 CTGAATCAGTAGGACTGCCATGG + Intergenic
1113408318 13:110062251-110062273 CTGAGTCAGAAACTCTGGCAGGG - Intergenic
1114334118 14:21670229-21670251 CTGAGGCAGCAGATCTCCAAGGG - Intergenic
1115153054 14:30307543-30307565 CTGATTCAGCAGATCTGAATGGG - Intergenic
1117798243 14:59416645-59416667 CTGATCCACCAGATTTGCCATGG - Intergenic
1118363416 14:65074693-65074715 AGGAGGCAGCAGAGCTGCCAAGG - Intronic
1119214358 14:72857049-72857071 CTGATTCAGCAGCTCTTCCAGGG - Intronic
1119436495 14:74600899-74600921 CTGATTCAGCAGATCTGGGGTGG - Intronic
1119968656 14:78944877-78944899 CTGATTCAGAAGATCTGGGATGG - Intronic
1121633443 14:95438023-95438045 CTGAGTTAGTAGATCTGGCTAGG - Intronic
1122509444 14:102254682-102254704 CTGATTCAGAAGGTCTGCAATGG + Intronic
1122851745 14:104537092-104537114 CTGAGTGAGCATCTCTGACATGG - Intronic
1123629685 15:22253081-22253103 CCGGGTAAGCAGGTCTGCCACGG + Intergenic
1125487242 15:40120549-40120571 CTGAGTCAGTAGGTCTGGGAGGG - Intergenic
1128299728 15:66558613-66558635 CTGATTCAGTAGGTCTGGCAAGG - Intronic
1129004192 15:72358545-72358567 CCTATTCAGCAGATCTGCAAAGG - Intronic
1131580248 15:93635928-93635950 GTCAGTCAGCAGAACAGCCATGG - Intergenic
1131761351 15:95626347-95626369 CTGATTCAGCAGATCTGGGGTGG - Intergenic
1131956262 15:97739476-97739498 CAGAGGCAGCAGACCTGACACGG - Intergenic
1135115288 16:19718466-19718488 CTGTGGGAGCAGATCTGCAAGGG + Exonic
1135271681 16:21075015-21075037 CTGATTCAGCAGGTCTGGGATGG - Intronic
1137578861 16:49621436-49621458 CTGAGTCATCATAACTCCCAGGG + Intronic
1138482930 16:57316097-57316119 CTGAGTTGGCAGAGCTGCCCTGG - Intergenic
1138490022 16:57371392-57371414 AAGAGTCAGCAGCTCTGCCTTGG - Intergenic
1139503018 16:67383478-67383500 CTGAGTCAGCAGGTCTGGGTTGG + Intronic
1140378568 16:74465497-74465519 CTGATTCAGCAGATCTGGAGGGG + Intronic
1140715301 16:77721033-77721055 CTGATTCAGCAGTTGTGACATGG + Intergenic
1141179958 16:81745775-81745797 CTGATTCAGCAGATCTGGAGGGG + Intronic
1141824171 16:86467606-86467628 CCATGTCAGCAGATCTGCGAAGG + Intergenic
1142753130 17:2000095-2000117 CTGCCTCAGCAGAACTGCAAAGG + Intronic
1143273975 17:5696254-5696276 CTGGGTCTGGAGATCTGCAAGGG + Intergenic
1143761319 17:9106064-9106086 CTGATTCAGCAGGTCTGGGATGG - Intronic
1144846252 17:18221207-18221229 CTGAGTCAGCAGCACTGGCAGGG - Intergenic
1145211243 17:21014937-21014959 CTGATTCAGCAGATCTGTGGGGG - Intronic
1146023204 17:29296445-29296467 CTGGGTCAACTGATCTGCCATGG - Intergenic
1149353374 17:55814477-55814499 CTGTGCCAGCAGCTGTGCCAAGG + Intronic
1149584927 17:57780046-57780068 ATGAGGCACCAAATCTGCCAGGG + Intergenic
1150289838 17:63974789-63974811 CTGAGTCACCAGAGCTCCCCAGG + Intergenic
1150375406 17:64677242-64677264 CTGAGCCAGGAGAACTGGCAGGG - Intergenic
1151069540 17:71192999-71193021 TTCAGTCAGCAGACTTGCCATGG - Intergenic
1151287069 17:73119869-73119891 CTGACTCAGTAGGTCTGGCATGG - Intergenic
1151426016 17:74031592-74031614 CTGATTCAGCAGATCTGGGCTGG + Intergenic
1151595987 17:75078234-75078256 CTGAGTGAGCAGCTCTGCTCTGG - Intergenic
1151625491 17:75272948-75272970 GTGAGTAGGCAGATGTGCCAGGG + Intergenic
1152176244 17:78789437-78789459 AGGACTCAGCAGCTCTGCCAGGG + Intronic
1152527948 17:80900235-80900257 CTGAGCCAGCAGCTCTGGCCTGG + Intronic
1152675956 17:81641376-81641398 CTGAGTCTTCAGATCTTCCTCGG - Intronic
1155190012 18:23421506-23421528 GTCAGTCAGCAGATCTGCTGGGG - Intronic
1156751868 18:40468566-40468588 ATGAGGCAGTAGATCTGTCAGGG + Intergenic
1158040238 18:53084560-53084582 CTGAAACAGAAGATCTGGCAGGG - Intronic
1158167989 18:54563269-54563291 CTGAGCCAGGAGTACTGCCACGG - Intergenic
1158514043 18:58116427-58116449 CTGATGCAGCAGATCTGCAGAGG - Intronic
1158613088 18:58961166-58961188 CTGATTCAGCAGGTCTGGGATGG + Intronic
1159107552 18:64020540-64020562 CTAAGTCAGCTCCTCTGCCAAGG + Intergenic
1159600818 18:70427148-70427170 CACAGTCAGCAGCTCTGACATGG - Intergenic
1160769588 19:824443-824465 CTGAGGCAGCAGATCAGCTGAGG - Intergenic
1162502945 19:11064905-11064927 CTGAGTCAGCGGCTCTGCCCGGG + Intronic
1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG + Intronic
1163631826 19:18421468-18421490 CTGATTCAGCATATCTGCCCTGG + Intronic
1164983352 19:32630487-32630509 CGGAGGCATCAGCTCTGCCAGGG + Intronic
1166586959 19:43957748-43957770 CTGAGACAGCAAATCTGATAAGG + Intronic
925113285 2:1354262-1354284 CTCAGGCAGCCGCTCTGCCACGG - Intronic
925113309 2:1354368-1354390 CTCAGGCAGCCGCTCTGCCACGG - Intronic
925113331 2:1354475-1354497 CTCAGGCAGCCGCTCTGCCACGG - Intronic
925113377 2:1354705-1354727 CTCAGTCAGCCGCTCTGCCTCGG - Intronic
925619385 2:5776203-5776225 CTGATTCAGCAGGTCTGCAGTGG + Intergenic
925632242 2:5906522-5906544 CTGAGCAAGCAGCTCTCCCATGG + Intergenic
926283729 2:11471054-11471076 CTGATTCAGTAGATCTGCACAGG - Intergenic
926996141 2:18737901-18737923 CTGATTCAGCAGATCTGGGGTGG + Intergenic
927169134 2:20353671-20353693 CTGATTAAGCTGATCTGGCATGG - Intergenic
929059579 2:37909713-37909735 TTGACTCAATAGATCTGCCATGG + Intergenic
929617150 2:43320458-43320480 CTGCCTCAACAGATCTGCAAAGG - Exonic
930489332 2:52048122-52048144 CTGAGTCTGCAGATCAGCTTGGG - Intergenic
931830798 2:66049316-66049338 CTGAGTCAGCAGGTCTGGTGTGG + Intergenic
934932820 2:98442153-98442175 CTGATTCAGCAGATCTGGGATGG + Intergenic
935239039 2:101162325-101162347 GTGAGTCTGCACATGTGCCAAGG + Intronic
935496134 2:103783658-103783680 CTGATTCAGCAGCTCTGCGATGG - Intergenic
939372511 2:141320011-141320033 CTGATTCAGTAGATTTGGCATGG + Intronic
940233074 2:151479041-151479063 CTGATTCAGTAGATCTGCATTGG + Exonic
941434802 2:165456292-165456314 GAGAGTCAGCAGATGTCCCAAGG - Intergenic
942524621 2:176840159-176840181 CTGAGTCAGATGGGCTGCCAAGG - Intergenic
942542636 2:177030740-177030762 CTCAGTTAACAGATCAGCCAGGG + Intergenic
942719859 2:178939415-178939437 CATAGTCAGGAGATATGCCAGGG + Intronic
943052902 2:182938064-182938086 CTGAGTCAGCAGGTCTGAGGTGG + Intronic
945048149 2:205799881-205799903 CTGATTCAGTAGATCTGGGATGG - Intergenic
945442329 2:209894591-209894613 CTGATTCAGCAGATCTGGGGTGG + Intronic
947083110 2:226420757-226420779 CTGAATCAGCAAATCTTTCAAGG - Intergenic
947182520 2:227424127-227424149 CTGATTCAGCAGTTCTGGGAGGG - Intergenic
947215835 2:227749282-227749304 CTGAGACAGCAGAACTGCTTGGG - Intergenic
947269124 2:228313986-228314008 TTGAGTCAGCGTATATGCCATGG + Intergenic
947796200 2:232895557-232895579 CTGAGCCCGCACAGCTGCCAAGG + Intronic
1168733188 20:105014-105036 CATAGTCATCAGATTTGCCAAGG + Intergenic
1168958892 20:1854822-1854844 ATGATTCAGTAGATCTGCAATGG - Intergenic
1169124397 20:3116539-3116561 CTGAGTCACCAAGTCTGTCAAGG + Intronic
1169183313 20:3590355-3590377 CTGATTCTTCAGATCTGCCTTGG - Intronic
1169743820 20:8922757-8922779 CTGAGTCAGCAGGCCTGGGAAGG + Intronic
1170464940 20:16613938-16613960 CTGATTCAGAAGATCTGGGATGG - Intergenic
1170519892 20:17173962-17173984 CTGAGGCAGCAGATCTGGAGTGG - Intergenic
1170584035 20:17720940-17720962 CTGACTCAGCAGGTCTGGGACGG - Intronic
1170713283 20:18810768-18810790 TTGATTCAGCAGATCTGGCATGG + Intronic
1170851386 20:20007903-20007925 CTGATCCAGCAGGTCTGCCAGGG - Intergenic
1171428114 20:25061164-25061186 CTGAGGCAGCAGGTCTGAGATGG - Intergenic
1171943994 20:31359735-31359757 CTGATTCAGTAGATCTGTAATGG - Intergenic
1172013298 20:31858838-31858860 CTGATTCTGCAGATCTGGGATGG - Intronic
1172152287 20:32798902-32798924 CTGAGTTAGCAGAGCTGAGAGGG + Intronic
1172911663 20:38414018-38414040 CTGATTCAGCAGATTTGGGATGG - Intergenic
1174039142 20:47686810-47686832 ATGAGGCTGCAGATCAGCCAGGG - Intronic
1174363490 20:50042784-50042806 CTGAGGCAGCAAATGTGCAATGG - Intergenic
1175742532 20:61430038-61430060 CTGAGTCAGCAGATTTCCCATGG + Intronic
1177816914 21:25987736-25987758 CTGAGACAGCAGCTCTGACATGG + Intronic
1177833752 21:26169394-26169416 CAGAGTCCCCAGAGCTGCCAGGG + Intronic
1179100568 21:38352379-38352401 CAGAGGCATCAGATCTGCCCGGG + Intergenic
1180056261 21:45360635-45360657 CTGAGGCAGGAGAACTGCCCGGG - Intergenic
1181798440 22:25327389-25327411 CTGAGGCCCCAGATCTGCCTGGG + Intergenic
1182871948 22:33655381-33655403 CTGAATCACCAGATCTTCCTGGG + Intronic
1183074603 22:35419064-35419086 CTGATTCAGCACCTCTGCCAGGG + Intronic
1184306736 22:43608111-43608133 CTCACTCAGCAGATATGCAATGG - Intronic
949130745 3:497613-497635 CTGATTCAGCAGATCCGAGATGG + Intergenic
949695878 3:6695037-6695059 CTGTATTAGCAGATCTGCCTGGG + Intergenic
950212018 3:11130703-11130725 CTGAGACAGCAGATGTGCAGGGG - Intergenic
950901627 3:16503286-16503308 CTGATTCAGCAGGTCTGGGATGG - Intronic
951236359 3:20240741-20240763 CTGAGCCAGTATCTCTGCCAAGG - Intergenic
951620010 3:24591388-24591410 CTGATTCAGCAGATCTGGGTTGG - Intergenic
951771188 3:26259360-26259382 CTAATTCAGCAGATCTGGGATGG - Intergenic
951926380 3:27913143-27913165 CTGATTCAGCAGGTCTGGCATGG + Intergenic
952311437 3:32194019-32194041 CTGATTCAGCAGGTCTGCATGGG + Intergenic
952324392 3:32307774-32307796 CTGAGTCAGTAGATCTGGAGTGG + Intronic
956467520 3:69534066-69534088 CTGATTCAGTAGATCTGGTACGG - Intronic
957337992 3:78857627-78857649 CTGAGTCAGCAGGTCTGGGGTGG - Intronic
959745615 3:109773276-109773298 CTGAGCCATTACATCTGCCATGG - Intergenic
960669890 3:120145740-120145762 CTGATTCAGCAGATCTGGGTGGG + Intergenic
961243721 3:125433957-125433979 CTGAGTCAGCAGGTCTGGTTGGG + Intergenic
961467471 3:127090464-127090486 TAGGGTGAGCAGATCTGCCAGGG - Intergenic
963410062 3:144916013-144916035 CTGAGTCAGTAGGTCTGAGATGG + Intergenic
964429763 3:156592803-156592825 TTGAGTCAGCAGACCTGGAAAGG + Intergenic
965806293 3:172545943-172545965 CTGAGGCAGGAGAACTGCCCAGG - Intergenic
966458600 3:180147528-180147550 ATGGGTCAGCTTATCTGCCAAGG + Intergenic
967743851 3:193032711-193032733 CTGATTTAGTAGATCTGGCAAGG - Intergenic
967854058 3:194103311-194103333 CTGATTCAGCAGCTCTGGTATGG + Intergenic
968047671 3:195632965-195632987 CTGAATCAGAAGATCTGGGAGGG - Intergenic
968306941 3:197656959-197656981 CTGAATCAGAAGATCTGGGAGGG + Intergenic
968337549 3:197926219-197926241 CTGACTCAGCAGGTCTGGGAGGG + Intronic
969322997 4:6424378-6424400 CTAAGTCAGCAGATATGACCTGG + Intronic
969461500 4:7331491-7331513 CTGAGGCATCAGCTCTACCAGGG - Intronic
970585468 4:17510790-17510812 CAGAGGCAGCACTTCTGCCAAGG - Intronic
971091281 4:23348605-23348627 CTGATTCAGCAGATCTTGGATGG + Intergenic
972057301 4:34819305-34819327 CTGGGTGATGAGATCTGCCATGG + Intergenic
973961436 4:56114118-56114140 TTGAGCCACCAGATCAGCCATGG - Intergenic
976033541 4:80788038-80788060 CTGATTCAGTAGGTCTGCAATGG + Intronic
976491336 4:85674142-85674164 CTGATTCAGTAGATCTGCGGTGG + Intronic
977114630 4:93007940-93007962 CTGAGGCAGGAGAACTGCCCAGG + Intronic
977615670 4:99085526-99085548 CTGATTCAGCAGGTCTGGCATGG + Intronic
978697061 4:111595184-111595206 CTGATTCAGTAGATCTGACATGG + Intergenic
981578897 4:146232678-146232700 CTTAGACTGCTGATCTGCCATGG + Intergenic
983249198 4:165325996-165326018 CTGACTCAGCTGGTCTGACAAGG - Intergenic
987386604 5:17335946-17335968 CTGAGTCAATAAATCTGACACGG + Intergenic
988721749 5:33885963-33885985 CTGAGTTAGAAGAACTGCAACGG + Intronic
990902559 5:60768803-60768825 CTGAGAGAGAAGATCTCCCAGGG - Intronic
991616729 5:68504707-68504729 CTGACTTAGCAGATCTGTGATGG - Intergenic
991912822 5:71578448-71578470 ATGATTCAGCAGATCAGCCTGGG + Intergenic
992791910 5:80221151-80221173 CTGCTTCAGCAGATCTGGGATGG - Intronic
993936981 5:94016747-94016769 CTGAGACAGCATATCTGATATGG - Intronic
999292720 5:150437294-150437316 CTGATTCAGTAGATCTGGGATGG - Intergenic
999918222 5:156287259-156287281 CTTATTCAGCAGATCTGGAAGGG + Intronic
1000380253 5:160622492-160622514 GTCAGACAGCAGACCTGCCAAGG - Exonic
1001727907 5:173922694-173922716 CTGATTCACCAGATTTGCCATGG + Intronic
1003880371 6:10475215-10475237 TTGACACAGCAGATCTGGCATGG - Intergenic
1003882916 6:10494576-10494598 CAGACTCAGCAGAGCTGGCAGGG - Intronic
1004995612 6:21189186-21189208 CTGATTCAGTAGAACTGCCTCGG + Intronic
1006556738 6:34873338-34873360 CTGGGAAAGCAGATGTGCCAGGG - Exonic
1007180636 6:39926925-39926947 CAGAGTCAGCAGTGCTGGCATGG + Intronic
1007945442 6:45822598-45822620 CTGAGTCAGTAGGTCTTCGATGG + Intergenic
1008277269 6:49556133-49556155 CTGATTCAACAGATCTGGAATGG - Intronic
1010357710 6:74953893-74953915 CTGAATCAGTAGGTCTGGCATGG - Intergenic
1012033456 6:94102002-94102024 CTGATTCAGTAGGTCTGCAAGGG - Intergenic
1014079767 6:117272485-117272507 CTGGGTCAGCAGATCAGCTCAGG - Exonic
1014097083 6:117472284-117472306 CTGAGGCAGCAAATTTGACAAGG + Intronic
1015497472 6:133896052-133896074 CTGAGCCAGCGGATCTGCAGCGG - Intergenic
1016657621 6:146540010-146540032 CTGATTCAGCATATCTGGGATGG - Intergenic
1017683110 6:156883835-156883857 CTGAGTAGGCTGAACTGCCAGGG - Intronic
1018444420 6:163842107-163842129 CAGAGTCATCACACCTGCCAGGG - Intergenic
1021861793 7:24913294-24913316 CTGAGTCTGGAGGTCTGCCAGGG - Intronic
1022811864 7:33876833-33876855 CACAGTCAGCTGATCTGCTAAGG + Intergenic
1023018348 7:35987417-35987439 CTGAGGCTGCAGAGCTGCCCAGG + Intergenic
1023753415 7:43393289-43393311 CTGAGGCTGCAGGCCTGCCAGGG - Intronic
1024105088 7:46075310-46075332 CTGAGGTAGCAGAGATGCCATGG + Intergenic
1024192818 7:47030156-47030178 CAGAGTGAGAAGATCTGTCAGGG - Intergenic
1025815109 7:64903664-64903686 CTGCGGCAGCAGAGCTGCCCAGG - Intronic
1027164246 7:75823378-75823400 CTGACTCACCAGATCTGGGATGG + Intergenic
1027645409 7:80791143-80791165 CAGCGTCAGCAGTTCTGGCAAGG + Intronic
1030788516 7:113693901-113693923 CTGATTCAGAAGGTCTGGCATGG - Intergenic
1031133351 7:117858891-117858913 CTGAGTCAGCAGATTTGTGGTGG - Intronic
1031974542 7:128085367-128085389 ATTAGCCAGCAGATCTGCCTGGG - Intronic
1032387208 7:131533225-131533247 CAGAGCCAACAGACCTGCCAGGG - Intronic
1033178432 7:139149324-139149346 GAGAGTCAACAGATATGCCAGGG - Intronic
1034881656 7:154767421-154767443 CAGAGTCACCAGATCTGCCCAGG - Intronic
1035336823 7:158134747-158134769 CATAGTCAGCAGAGGTGCCAGGG - Intronic
1038865658 8:31436395-31436417 CTGAGACAGCAAATCTGGTAAGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039842044 8:41301001-41301023 GTGACTAAGCAGATCTGCCAAGG + Intronic
1041314137 8:56544161-56544183 CTGAGGCATCAGTCCTGCCATGG - Intergenic
1042439981 8:68814241-68814263 CTGATTCAGTAGATCTGGGATGG - Intronic
1043386652 8:79755631-79755653 CTGAGTCTGCAGATTTGGGATGG + Intergenic
1043648667 8:82558828-82558850 ATGAGTAAGCAGATATCCCAAGG + Intergenic
1045318542 8:101063846-101063868 CTGACACAGCAGAACTCCCAGGG + Intergenic
1045961786 8:107977354-107977376 CTGATTCAGTAGATCTGAGATGG - Intronic
1047991690 8:130293198-130293220 CTGATTCAGCAGGTCTGACGAGG + Intronic
1048057876 8:130885997-130886019 TGGAGTCAGCAGATCTGGCTTGG - Intronic
1048139769 8:131782901-131782923 CTGAGTCAGCAGGTCTGGTGTGG - Intergenic
1049576929 8:143393850-143393872 CTGGGTCAGCAGATCCGCTCCGG - Intergenic
1049730444 8:144174854-144174876 CTGACTCAGCAAGTCTGCAATGG - Intronic
1052108455 9:24548908-24548930 CTGAGAAATCAGATCTACCATGG - Intergenic
1052253474 9:26426892-26426914 CTGAGTCTGCTGAGTTGCCAGGG - Intergenic
1053115906 9:35502114-35502136 CTGATTCAGTACATCTGGCATGG + Intronic
1053477676 9:38393720-38393742 CTGAGTCAGCAGATCTGCCAGGG - Intronic
1054711331 9:68514098-68514120 CTGAGTCAGTAGATCTGGGTTGG - Intronic
1054775895 9:69123039-69123061 CTGATTCAGCAGATCTGGGTGGG - Intronic
1054916499 9:70499444-70499466 CGGATTCAGCACATCTGCCATGG - Intergenic
1056364250 9:85887190-85887212 CTGACTCAGAAGATCTGCAGTGG + Intergenic
1056715344 9:89023957-89023979 CTGACTCAGCAGATCTGGGGTGG + Intronic
1056749106 9:89333507-89333529 CTGGCTCTGTAGATCTGCCATGG + Intronic
1056801851 9:89697689-89697711 CTGATTCAGCAGGTCTGGGATGG + Intergenic
1057279569 9:93700033-93700055 CTGAGTGTGCAGATGTGACAAGG - Intergenic
1058637038 9:107047336-107047358 CTGTTTCAGCAGATCTGGTAAGG + Intergenic
1058880856 9:109285073-109285095 CTGCAGCAGCAAATCTGCCATGG + Intronic
1059473224 9:114523060-114523082 CTGATTCAGCAGATCTGGGGTGG - Intergenic
1059723971 9:116987854-116987876 CTCAGTTATCAGATCTGTCAAGG - Intronic
1061452417 9:130675489-130675511 CTGAGCCAGCAGAGCTGCAGAGG - Intronic
1061972958 9:134054631-134054653 CACAGGCAGCAGCTCTGCCATGG + Intronic
1062678686 9:137763998-137764020 CTGATTCAGCAGGTCTGGCCTGG + Intronic
1186105821 X:6204693-6204715 CTGAGTCAGCAGATCTGAGATGG - Intronic
1186399184 X:9241122-9241144 CTGACTCAGCAGGTCTGGGATGG - Intergenic
1186833898 X:13418418-13418440 CAGAGTCAGCAGTTCTGACTAGG - Intergenic
1186980447 X:14952682-14952704 CTGATTCAGTAGATCTGGCCTGG + Intergenic
1186989086 X:15048514-15048536 CTGATTCAGTAGATCTGAGATGG + Intergenic
1187027669 X:15452777-15452799 CTGATTCAGCACATCTGAGATGG - Intronic
1187103044 X:16214647-16214669 CTGGGTCAGCAGATCTGGGATGG + Intergenic
1187147613 X:16651861-16651883 CTGAGTCAGGACACTTGCCAAGG + Intronic
1187238763 X:17493726-17493748 CTGACTCAGTAGATCTGGCGTGG - Intronic
1187257115 X:17653870-17653892 CTGATTCAGCAGGTCTGGGAAGG + Intronic
1188283738 X:28302826-28302848 CTGATTCAGTAGATCTGAGATGG - Intergenic
1188307322 X:28574025-28574047 CTGATTCAGTAGATCTGAAATGG + Intergenic
1188613295 X:32125949-32125971 CTGATTCAGTAGATCTGGGATGG - Intronic
1190887072 X:54539664-54539686 CTGATTCAGTAGGTCTGGCATGG + Intronic
1191965487 X:66752727-66752749 CTGAGCCAGTTGATCAGCCATGG - Intergenic
1192232622 X:69276522-69276544 CTGATTCAGTGGATCTGCCATGG + Intergenic
1195726673 X:107924667-107924689 CTGAGTCCACAAATCTCCCATGG - Intronic
1196757900 X:119173931-119173953 CTGAGTCAACAGATCTGGGGTGG - Intergenic
1196820992 X:119700559-119700581 CTGATTCAGCAGATCTGAGGTGG - Intergenic
1198141097 X:133804326-133804348 CTGATTCAGCACATCTGGAATGG - Intronic
1200291155 X:154875568-154875590 CTGATTCAGTAGAACTGACATGG - Intronic