ID: 1053478023

View in Genome Browser
Species Human (GRCh38)
Location 9:38396030-38396052
Sequence CCCGCTCAGAGGCATCCATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053478023_1053478032 15 Left 1053478023 9:38396030-38396052 CCGGATGGATGCCTCTGAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1053478032 9:38396068-38396090 GCCTGGCAGACCTAGTGGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 180
1053478023_1053478030 10 Left 1053478023 9:38396030-38396052 CCGGATGGATGCCTCTGAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1053478030 9:38396063-38396085 GAACCGCCTGGCAGACCTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1053478023_1053478028 -2 Left 1053478023 9:38396030-38396052 CCGGATGGATGCCTCTGAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1053478028 9:38396051-38396073 GGGCCGGCTGCTGAACCGCCTGG 0: 2
1: 0
2: 0
3: 10
4: 136
1053478023_1053478034 16 Left 1053478023 9:38396030-38396052 CCGGATGGATGCCTCTGAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1053478034 9:38396069-38396091 CCTGGCAGACCTAGTGGAGCGGG 0: 1
1: 0
2: 1
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053478023 Original CRISPR CCCGCTCAGAGGCATCCATC CGG (reversed) Exonic